Homework Answers
ANSWER
- If the codon changed, it's because the nucleotides in the DNA / RNA sequence changed.
- A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.
- genetic code describes the relationship b/w the sequence of DNA bases (A, C, G, and T) in a gene and the corresponding protein that it encodes
- A Mutation leads to a change in the CODON of DNA/RNA sequence.
- a codon is a unit of genetic code.
- Cells decode mRNAs by reading their codons.
Add Answer to:
If the codon changed, it's because the nucleotides in the changed. sequence
5. Fill in the blanks to summarize how change, or a mutation, happens in a cell...
5. Fill in the blanks to summarize how change, or a mutation, happens in a cell If a doesn't work right, it's probably because it folded wrong. If it folded wrong, it's probably because the changed. of amino acids was If an amino acid changed, it's because the 3- mRNA was changed. codon in the If the codon changed, it's because the nucleotides in the changed. sequence
The six nucleotides preceding the start codon and the first nucleotide after the start codon in...
The six nucleotides preceding the start codon and the first nucleotide after the start codon in eukaryotes exhibit strong sequence preference as determined by the percentages of nucleotides in the -6 to -1 positions and the +4 position. Use the data given in the table to determine the six nucleotides that most commonly precede the start in vertebrates. Express your answer as a sequence of nucleotides separated by dashes. Example: 5'-C-A-T-G-...-3' Use the data given in the table to determine...
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False;...
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False; in translation codon nucleotides are bound directly to amino acids False; in translation nucleotides are matched by complementarity but amino acid sequence is unrelated True; codons matching anti-codons is the only process where complimentary nucleotides associate True; nucleotides on mRNA and on tRNA are complimentary (the operon and anti-codon) and the tRNA carries a single amino acid
Suppose each of nucleotides A, G, C and T has at the same frequency in a...
Suppose each of nucleotides A, G, C and T has at the same frequency in a DNA sequence and the nucleotides appear at random. What is the average distance between two stop codons? a. about 5 codon b. about 64 codons c. about 10 codon d, about 21 codon
Use the codon sequence below to translate the following mRNA sequence (remember to start with the...
Use the codon sequence below to translate the following mRNA sequence (remember to start with the start codon - AUG - codes for methionine): mRNA sequence - AUGUAUAAGUAA [ Choose ] methionine lysine Stop tyrosine 1st codon 2nd codon 3rd codon 4th codon 2. Choose terms that are associated with eukaryotic transcription control. Group of answer choices operators transciption factors repressors enhancers
9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what...
9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what will the RNA codon be? What amino acid and/or function does this RNA codon code for? What RNA codon(s) code for the amino acid arginine (ARG)? What RNA codon codes for tryptophan (TRP)? What was the DNA sequence that was transcribed to make this codon? (backwards transcribe it) If the last nucleotide (letter) in the TRP codon changes to a "U," will the amino...
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of...
Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of the sequence changed a codon from a AAA to a UAA then what would be a reasonable prediction 0 The protein coded by his mRNA would be longer O The protein coded by this mRNA would kilthe cell O The protein coded by this mRNA would be the same size O The protein coded by this mRNA would be shorter O The protein coded...
3 attempts left Check my work An essential gene has the codon 5-UUA-3' in a critical position. If this codon is mut...
3 attempts left Check my work An essential gene has the codon 5-UUA-3' in a critical position. If this codon is mutated to the sequence 5-UUG-3', what is the expected consequence for the cell? Select all that apply. This change results in a positive mutation. The primary sequence of the protein would not be changed. The primary sequence of the protein would be changed. @ This change results in a silent mutation. This change results in a negative mutation.
5. Fill in the blanks to summarize how change, or a mutation, happens in a cell If a doesn't work right, it's probably because it folded wrong. If it folded wrong, it's probably because the changed. of amino acids was If an amino acid changed, it's because the 3- mRNA was changed. codon in the If the codon changed, it's because the nucleotides in the changed. sequence
The six nucleotides preceding the start codon and the first nucleotide after the start codon in eukaryotes exhibit strong sequence preference as determined by the percentages of nucleotides in the -6 to -1 positions and the +4 position. Use the data given in the table to determine the six nucleotides that most commonly precede the start in vertebrates. Express your answer as a sequence of nucleotides separated by dashes. Example: 5'-C-A-T-G-...-3' Use the data given in the table to determine...
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary
Suppose each of nucleotides A, G, C and T has at the same frequency in a DNA sequence and the nucleotides appear at random. What is the average distance between two stop codons? a. about 5 codon b. about 64 codons c. about 10 codon d, about 21 codon
9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what will the RNA codon be? What amino acid and/or function does this RNA codon code for? What RNA codon(s) code for the amino acid arginine (ARG)? What RNA codon codes for tryptophan (TRP)? What was the DNA sequence that was transcribed to make this codon? (backwards transcribe it) If the last nucleotide (letter) in the TRP codon changes to a "U," will the amino...
Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of the sequence changed a codon from a AAA to a UAA then what would be a reasonable prediction 0 The protein coded by his mRNA would be longer O The protein coded by this mRNA would kilthe cell O The protein coded by this mRNA would be the same size O The protein coded by this mRNA would be shorter O The protein coded...
3 attempts left Check my work An essential gene has the codon 5-UUA-3' in a critical position. If this codon is mutated to the sequence 5-UUG-3', what is the expected consequence for the cell? Select all that apply. This change results in a positive mutation. The primary sequence of the protein would not be changed. The primary sequence of the protein would be changed. @ This change results in a silent mutation. This change results in a negative mutation.
Most questions answered within 3 hours.
-
A speeding car is traveling along a straight road with a
constant speed of 100 km/hour....
asked 32 seconds ago -
When 60.1 gg of calcium is reacted with nitrogen gas, 31.7 gg of
calcium nitride is...
asked 5 minutes ago -
The random variable X is exponentially distributed, where X
represents the time it takes for a...
asked 20 minutes ago -
a) Write a verilog module for 1:4 Demultiplexer using verilog
primitives.
b) Design 1-to-4 DEMUX using...
asked 14 minutes ago -
MATLAB
write a MATLAB function (1) output a third-order polynomial
function with the coefficients as the...
asked 27 minutes ago -
A z-score
communicates a raw score’s "relative standing"
under the normal curve in relation to:
asked 36 minutes ago -
An object is vibrating on a spring with the following equation
of motion:
?=(30 ??)cos((2?)/(160)?)
a)...
asked 35 minutes ago -
Vulcan Flyovers offers scenic overflights of Mount St. Helens,
the volcano in Washington State that explosively...
asked 38 minutes ago -
If organizations do not adapt fast enough and move incrementally
from the twentieth-century model to the...
asked 38 minutes ago -
A helium balloon with 2.5L of gas has a gauge pressure of 10,000
Pa. The balloon...
asked 43 minutes ago -
What is responsible for Jupiter's enormous magnetic field?
asked 58 minutes ago -
At the end of the year, a company offered to buy 5,000 units of
a product...
asked 59 minutes ago