The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...
The strand below is a piece of DNA coding strand
5' - ACTCCGGGTGAGGTATCAAT - 3'
Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence.
Homework Answers
5”ACUCCGGGUGAGGUAUCAAU 3” - Sequence of mRNA will be same as coding strand except that Ts in the DNA coding strand are replaced by Us in RNA
Add Answer to:
The strand below is a piece of DNA coding strand
5' - ACTCCGGGTGAGGTATCAAT - 3'
Its...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
4. Given the following information: One strand of a section of DNA isolated from E. coli...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
#8 . Metro by T-Mobile LTE 10:40 PM 69% Done 9 of 9 Is coding strand...
#8
. Metro by T-Mobile LTE 10:40 PM 69% Done 9 of 9 Is coding strand so assume both could be the coding strand 5' - GCTAATGCACOTT - 3 3' - OGATTACGTGCAA - 5 5-CGALUAC GUGCAA - 3 3-GCUAAUGCACGUU - 5 As opposed to DNA replication or transcription, translation requires the correct reading frame. a) Use the sequence below to illustrate what the reading frame" on an mRNA refers to 5' UUGCAYUGSAGC 3' b) Write out ALL of the possible...
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand...
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand DNA template: 3' ------ 5' ______________ ______________ _____________ ____________ ____________ mRNA Strand: 5'------3' _____________ _____________ ____________ ____________ ______________
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.
7. Open reading frames A protein coding gene includes the following sequence on one of its...
7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
#8
. Metro by T-Mobile LTE 10:40 PM 69% Done 9 of 9 Is coding strand so assume both could be the coding strand 5' - GCTAATGCACOTT - 3 3' - OGATTACGTGCAA - 5 5-CGALUAC GUGCAA - 3 3-GCUAAUGCACGUU - 5 As opposed to DNA replication or transcription, translation requires the correct reading frame. a) Use the sequence below to illustrate what the reading frame" on an mRNA refers to 5' UUGCAYUGSAGC 3' b) Write out ALL of the possible...
7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
Most questions answered within 3 hours.
-
Complete the following probability table. (Round Prior
Probability and Posterior Probability answers to 2 decimal places...
asked 4 minutes ago -
In carrying out the first standardization in an experiment, a
student used 0.5449g of potassium hydrogen...
asked 4 minutes ago -
There are n candies on the table. Alice and Bob independently
pick k random candies each....
asked 7 minutes ago -
There are 32 chocolates in a box, all identically shaped. There are
12 filled with nuts,...
asked 8 minutes ago -
Consider the following information:
State Probability Stock A Stock B Stock C
Boom 0.65 0.26 0.17...
asked 7 minutes ago -
The equilibrium constant, Kp, for the following reaction
is 0.110 at 298 K:
NH4HS(s)
->NH3(g) +...
asked 12 minutes ago -
This program should be in c++.
Rock Paper Scissors: This game is played by children and...
asked 11 minutes ago -
The Pluralist Theory holds that large groups, instead of
the electorate, actually control the democratic process...
asked 23 minutes ago -
Arduino programming
Write the syntax for the analogWrite() function in order to
output an effective 2V...
asked 30 minutes ago -
Tartaric acid is a diprotic acid we can represent as
H2T. Suppose a 100mL solution, which...
asked 30 minutes ago -
A bacteria has a doubling period of 6 days. If there are 3300
bacteria present now,...
asked 51 minutes ago -
Determine the PH of a 0.232M mg (OH)2 solution at 25 degree
Celsius.
asked 48 minutes ago