DNA sequence of a one strand of a gene to be transcribed is:
3’ — AGTCCGATGGGCT GA — 5’
the sequence of the MRNA is:
3’ — AGUCCGAUGGGCTGA — 5’
the sequence of the DNA strand shown above is that of the:
a. template strand
b. coding strand
Hello
Welcome to HomeworkLib study.
Here the DNA strand sequence given is a b.) Coding strand.
After transcription the mRNA formed is always complementary to template strand and similar to coding strand except T is replaced by U.
Here both DNA and mRNA strand are similar so the DNA strand is of coding strand.
( NOTE:- There is misprint in the mRNA strand, from the 5' end third base pair is T which is not possible in RNA. RNA never have T as its base pair.)
I hope my answer will be of some help to you.
Thank you.
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...