Homework Answers
Add Answer to:
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence.
“Unlike what happens in DNA replication, where both strands are copied, only one of the two...
“Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...
Original DNA sequence (coding strand), starting at the beginning of the gene: Normal: 5'-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA......
Original DNA sequence (coding strand), starting at the beginning of the gene: Normal: 5'-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA... 30. Can a single nucleotide be a conserved sequence? Explain your answer. (4 Points) 31. Explain why self-splicing introns support the RNA world first Hypothesis (life evolved via RNA). (3 Points)
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
The gene in the diagram is transcribed by RNA polymerase from left to right. If the...
The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
Original DNA sequence (coding strand), starting at the beginning of the gene: Normal: 5'-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA... 30. Can a single nucleotide be a conserved sequence? Explain your answer. (4 Points) 31. Explain why self-splicing introns support the RNA world first Hypothesis (life evolved via RNA). (3 Points)
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS
Most questions answered within 3 hours.
-
Calculate the pH of each of the following solutions.
0.50 M HBr
3.1×10−4 M KOH
4.2×10−5...
asked 1 hour ago -
For the year ended December 31, Depot Max’s cost of merchandise
sold was $85,600. Inventory at the...
asked 1 hour ago -
Week 10 - Professional Memo Assignment
Professional Memo Assignment
Your mission for this week, should you...
asked 1 hour ago -
Write a Python program that stores the data for each
player on the team, and it...
asked 1 hour ago -
In
the last 3 months, mike never knows when he is going to get his
allowance...
asked 1 hour ago -
Is Ca(OH)2 a Bronsted base, Lewis base, or both? Why?
asked 1 hour ago -
1A- Why don’t voters complain about U.S. tariffs on imported
sugar?
Because sugar is only a...
asked 1 hour ago -
Cash Payback Period
Primera Banco is evaluating two capital investment proposals for
a drive-up ATM kiosk,...
asked 1 hour ago -
Create a button in Swift (Xcode) that will create a charge,
create a charge using Stripe's...
asked 1 hour ago -
The reaction rate of CO and NO2 in the reaction
CO(g) + NO2(g) → CO2(g) +...
asked 1 hour ago -
Imagine that a chemist puts 6.40 mol each of
C3H8 and O2 in a 1.00-L container...
asked 1 hour ago -
How much money should be invested today in order to have $8340
at the end of...
asked 2 hours ago