ZuoTi.Pro
Question

The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RN

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Answer: Option (D) A and B

Explanation: In the process of transcription, the template DNA (3' to 5' polarity) is transcribed to mRNA (5' to 3' polarity). RNA polymerase moves from 3' end of the template DNA. In the given figure, movement of RNA polymerase is from right to left, thus 5' end of the template DNA is at left side.

0 0
Add a comment
Know the answer?
Add Answer to:
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • 6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA...

    6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right. a) Which end of the DNA template is the 5' end and which end is 3'? b) What is the sequence of the complimentary DNA strand? c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • 5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the...

    5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features...

    QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...

  • 5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)            ...

    5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)             ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)

  • Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С...

    Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С стената. 3. TTAGCATACGCTTCGGGAATTGA-5' The number of amino acids in the corresponding peptide is: OA.O B.1 OC3 0.4 O E.5 Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3 Strand 2A 3'-TTAG CATACGCTTCGGGAATTGA-5 The number of mRNA codons in the corresponding transcriptis O A1 OB.4 OC.5 OD.6 E. Cannot be determined

  • 11. A gene is best defined as a. A segment of DNA b. Three nucleotides that...

    11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT