5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)
ATTGCCAGATCATCCCAATAGAT
5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ...
6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right. a) Which end of the DNA template is the 5' end and which end is 3'? b) What is the sequence of the complimentary DNA strand? c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...