ZuoTi.Pro
Question

5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the writte

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

a. The template strand is in the direction of 3'-5' or the bottom strand. It is because the template strand has the same direction as the mRNA sequence.

b. The RNA polymerase moves from right-to-left in the direction of 5'-3'.

c. The sequence present in the nucleotides of processed (mature) mRNA is as follows:

5'-GGGGAUACGGGGGGACCCCCUCCUAGUUUUGUGAAUGGACAUGUACCC-3'

Basically the sequence will be same as 3'-5', only T will be replaced with U.

Hope it helps, Good luck !!!!!

PLEASE DO PRESS LIKES:)

1 1
Add a comment
Know the answer?
Add Answer to:
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help...

    The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help with part C A. Determine the mRNA sequence encoding this polypeptide fragment. 5'-G-G-N-G-A-Pu-A-U-G-U-A-Py-U-G-G-A-A-Pu-G-C-N-3' B. Determine the DNA template strand sequence corresponding to the mRNA above. 5' N-G-C-Py-T-T-C-C-A-Pu-T-A-C-A-T-Py-T-C-N-C-C- 3' C. Determine the DNA coding strand sequence corresponding to the template strand above. Express your answer as a sequence of nucleotides separated by dashes. Use N to represent any nucleotide (A, T, C or G), Pu...

  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • 1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...

    1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...

  • A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence...

    A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The intron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly-A tails are added following the sequence AGUUGG. The poly-A tails are 20 nucleotides. b. If this is an oncogene that is elevated in cancer cells, design two siRNAs to knock down the mRNA, list the sequences of the siRNAs...

  • Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop

    Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop

  • The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...

    The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C

  • 0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand...

    0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...

  • 1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The...

    1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...

  • The sequence below represents a middle section of the template strand of DNA of a structural...

    The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT