The amino acid sequence of a portion of a polypeptide is
N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C.
I just need help with part C
A. Determine the mRNA sequence encoding this polypeptide fragment. 5'-G-G-N-G-A-Pu-A-U-G-U-A-Py-U-G-G-A-A-Pu-G-C-N-3'
B. Determine the DNA template strand sequence corresponding to the mRNA above. 5' N-G-C-Py-T-T-C-C-A-Pu-T-A-C-A-T-Py-T-C-N-C-C- 3'
C. Determine the DNA coding strand sequence corresponding to the template strand above.
Express your answer as a sequence of nucleotides separated by dashes. Use N to represent any nucleotide (A, T, C or G), Pu to represent a purine( A, G), and Py to represent a pyrimidine (C, T). Example: C-T-Pu-N-.
DNA template strand = 3' to 5'
DNA coding strand = 5' to 3'
Both the strands are antiparallel and complementary to each other. Purine (A, G) will pair with pyrimidine (T, C).
So, coding strand sequence will be,
3' N C G Pu A A G G T Py A T G T A Pu A G N G G 5'
Please rate high.
The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help...
Which sequence is more soluble on water.
a. Glu-Lys-Leu-Met-His b. Lys-Ser-Ser-Tyr-Glu c. Asp-Phe-Trp-Met-His d. His-Tyr-Ser-Ala-Glu e. His-Ala-Cys-Gly-Glu o
Use the following information to answer questions 4-5. Polypeptide Val—Ala—Lys—Glu—Glu—Phe—Val—Met—Tyr—Cys—Glu—Trp—Met—Gly—Gly—Phe 4. List the peptides formed when the polypeptide shown above is treated with chymotrypsin. 5. Supposed the peptides resultinf from chymotrypsin treatment are then reacted with cyanogen bromide; list the products
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
Example question (p. 171). The amino acid sequence of a wild-type protein is Met-His-Ala-Trp-Asn-Gly-Glu–His-Arg The amino acid sequences of two mutants are: Mutant 1: Met-His-Ala-Trp-Lys-Gly-Glu–His-Arg Mutant 2: Met-His-Ala For each mutant, specify the type of mutation that has occurred, using the mutation classification system based on effect to protein function
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
Suppose part of the amino acid sequence of a protein is N... Gly
- Ala - Pro - Arg - Lys ...C. Which of the following amino acid
sequences could result from a frameshift mutation (+1 or -1) in the
part of the gene that encodes this sequence of amino acids?
Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...
N’-Val-Asp-Ala-Lys-Glu-Gly-Ser-Glu-Gly-Met-Ser-Lys-C' as they occur at pH 8 Tell in detail how to find an isoelectric point!
help with these please
Examine the peptide. Thr-Glu-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys Write the sequence using one-letter abbreviations. sequence: TKPIVAPMEYGK Estimate the net charge on the peptide at pH 7. charge at pH 7: Estimate the net charge on the peptide at pH 12. Alpha helices are a type of secondary structure in proteins. What is the length of a 23.0 kDa single-stranded a-helical protein segment? Assume a mean residue mass of 110 Da. length: Beta () sheets are a type of secondary structure...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...