Question

The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed from this gene? What would be the sequence removed from the immature RNA? Assuming that this would be the only modification to the mRNA before translation, what would be the sequence of amino acids coded by the gene?

Answer 1

Explanation:

• The genetic information in the fragment of DNA or a gene, may be expressed by its ability to encode a specific RNA or protein.
• The product thus generated typically “expresses” the genetic information of the gene. As described by the hypothesis of George Wells Beadle and Edward Lawrie Tatum, “One gene one enzyme”; the product of each genetic expression influences the activity of the cell.
• Thus, the process of transcription occurs to produce mRNA and translation to produce protein is defined as the central dogma.
• DNA - > mRNA - > Protein
• 5’ to 3’ strand of DNA serves as coding strand.
• 3’ to 5’ strand of DNA act as template strand.
• RNA is synthesized by complementary base pairing with the template strand.
• Thus, the RNA will have same sequence as coding strand (only T is replaced by U) and is oriented in 5’ to 3’ direction
• Eukaryotic gene contain, regions of “expressed sequence” or exons, which code for proteins and non-coding or” intervening sequence” or introns.
• The pre-RNA transcript requires splicing process, by which introns are removed, exons are joined to form mature RNA. The process of splicing is mediated by small nuclear ribonuclear proteins (snRNPs or SNURPS).

Answers:

Given template strand:

3' CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5'

Corresponding coding strand:

5' GTACCTGTCcattcttatgttgtgtcCAGCCGTACTGC 3’

Immature mRNA:

5' GUACCUGUCcauucuuauguugugucCAGCCGUACUGC 3’

mRNA with introns removed:

5' GUACCUGUCCAGCCGUACUGC 3’

Aminoacid:

VAL-PRO-VAL-GLN-PRO-TYR-CYS