Question

please help with all 3

Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU What would be the 5' UTR sequence? GUAACUU What would be the sequence of amino acids coded by this section of the gene? ASN-TYR-ALA-TYR

Answer 1

Answer-

According to the given question-

We know that the central dogma is DNA ---> RNA ---Protein, where the information present in the DNA is transferred to mRNA in the form of codons by the process of transcription with the help of DNA dependent RNA Polymerase in 5' to 3' direction, which is later translated into proteins.

Here we have a DNA sequence and we have to translate this sequence-

DNA sequence-                         5' GTAACTATAATTATGCGTATAATG 3'

Complementary DNA Sequence- 3' CATTGATATTAATACGCATATTAC 5' -----> Template strand or anti-sense strand used for transcription.

mRNA Sequence-                      5' GUAACUAUAAUUAUGCGUAUAAUG 3'

Promoter sequence- CATTGATA

5' UTR sequence- AAUU

Amino acid Sequence- N-Terminal - MET- ARG- ILE - MET - C- Terminal .