Homework Answers
1.350 nucleotide
Total exon nucleotide=1050
one aminoacid =1050/3=350
2.350 mRNA
3.44 kD
4.27 kD
Add Answer to:
QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
7. Open reading frames A protein coding gene includes the following sequence on one of its...
7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
Question 16: The following shows the same segment of DNA that was shown above in Question...
Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...
000_ U SEJJIBU contentId-_876188.1&step Question Completion Status: QUESTION 1 In eukaryotic genes, a. coding exons are...
000_ U SEJJIBU contentId-_876188.1&step Question Completion Status: QUESTION 1 In eukaryotic genes, a. coding exons are separated by noncoding introns b. coding introns are separated by noncoding exons c. all genes consist of an uninterrupted coding sequence d.genes can include the coding sequences for multiple proteins e. both (c) and (d) QUESTION 2 A gene with 8 exons would have ___ introns. b.9 0.8 d. 24 e. 16 QUESTION 3 The gene for rhodopsin has 5 exons and 6706 nucleotides....
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
Background Information How can we predict where a coding gene will be in bacteria? And can...
Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...
000_ U SEJJIBU contentId-_876188.1&step Question Completion Status: QUESTION 1 In eukaryotic genes, a. coding exons are separated by noncoding introns b. coding introns are separated by noncoding exons c. all genes consist of an uninterrupted coding sequence d.genes can include the coding sequences for multiple proteins e. both (c) and (d) QUESTION 2 A gene with 8 exons would have ___ introns. b.9 0.8 d. 24 e. 16 QUESTION 3 The gene for rhodopsin has 5 exons and 6706 nucleotides....
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Most questions answered within 3 hours.
-
A ski-jumper leaves the ski track moving in the horizontal
direction with a speed of 25.0...
asked 51 seconds ago -
Are there any potential drawback to the job-crafting approach?
If so, how can they be minimized?
asked 1 minute ago -
12. To accommodate growth until a new version of IP could be
standardized and adopted, a...
asked 5 minutes ago -
Create a separation scheme flow chart/diagram to isolate methyl
salicylate from a product mixture containing the...
asked 6 minutes ago -
5. The animals of which phylum use a water vascular system in
locomotion, feeding and gas...
asked 31 minutes ago -
*HOW DO I CHANGE THIS FROM A VOID FUNCTION TO A NON-VOID
WITH PARAMETERS?*
#include<iostream>
#include<fstream>...
asked 19 minutes ago -
I have a matrix, A= rand(2,3,2) ans(:,:,1) = 0.8116 0.3507
0.8759 0.5328 0.9390 0.5502 ans(:,:,2) =...
asked 23 minutes ago -
A commercial lubricant, Dubdeefordy, has K = SN/SM = 13.1 for
immiscible solvent M and N....
asked 23 minutes ago -
Examine several recent mergers and suggest the principal motives
for merging in each case. Discuss three...
asked 25 minutes ago -
If I want to make 50mL of 5M of NaCl, would I use: 14.6 grams of...
asked 31 minutes ago -
Find the expected value E(X), the variance Var(X) and the
standard deviation σ(X) for each of...
asked 40 minutes ago -
1.Mr. Bill S. Preston, Esq., purchased a new house for $90,000.
He paid $20,000 upfront and...
asked 41 minutes ago