Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene:
5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’
Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of RNA processing, draw a simple diagram and label the key reaction/enzymes to explain the mechanism. Do NOT describe in just words.
Homework Answers
The corresponding mRNA sequence is given below 5'AUU-UGC-GCU-ACC-UGG-CUG-GUA-UGU-CAU-AGC-UGC-GAG-GUC-CUA-CCA-UUU-UAU-UUA-CGG-A3'
Its corresponding peptide sequence is given below Isoleucine - Cysteine - Alanine - Threonine - Tryptophan - Leucine - Valine - Cysteine - Histidine - Serine - Cysteine - Glutamic acid - Valine - Leucine - Proline - Phenylalanine - Tyrosine - Leucine - Arginine
Thank you
According to Chegg guidelines, i cannot provide answer to more than one answer. I am really sorry for the inconvenience caused.
Add Answer to:
Below is the DNA sequence of a protein-encoding Eukaryotic
gene:
5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’
Based on this information, predict...
A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence...
A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The intron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly-A tails are added following the sequence AGUUGG. The poly-A tails are 20 nucleotides. b. If this is an oncogene that is elevated in cancer cells, design two siRNAs to knock down the mRNA, list the sequences of the siRNAs...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would:...
This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would: Be transcribed Encode a primary transcript that would be fully processed into mRNA, including having one intron spliced out Be translated into a protein with the amino acid sequence: MPLEASE. I suggest starting by writing out all of the sequence elements necessary for every step of transcription and translation, so that you make sure you include each of those elements in your gene. Report...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that...
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that renders that polymerase non-functional. Match each RNA polymerase mutation with all of the cellular processes that it would disrupt. Mutation in eukaryotic RNA polymerase I Mutation in eukaryotic RNA polymerase II Mutation in eukaryotic RNA polymerase III pre-mRNA processing RNA synthesispre-mRNA synthesis RNAi-mediated gene regulation IRNA synthesis mRNA translation rRNA processing
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
5. A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon...
5. A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5ʹ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene would be spliced. Indicate which introns and exons would be found in the mRNA after splicing occurs
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to...
A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to the 3' end of the second intron (introns 2/ exon three splice sites) draw the mRNA strand before and after splicing Diagram a final functional eukaryotic mRNA molecule from the 5' end to 3' end. There should be 7 items labeled in the diagram.
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would: Be transcribed Encode a primary transcript that would be fully processed into mRNA, including having one intron spliced out Be translated into a protein with the amino acid sequence: MPLEASE. I suggest starting by writing out all of the sequence elements necessary for every step of transcription and translation, so that you make sure you include each of those elements in your gene. Report...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that renders that polymerase non-functional. Match each RNA polymerase mutation with all of the cellular processes that it would disrupt. Mutation in eukaryotic RNA polymerase I Mutation in eukaryotic RNA polymerase II Mutation in eukaryotic RNA polymerase III pre-mRNA processing RNA synthesispre-mRNA synthesis RNAi-mediated gene regulation IRNA synthesis mRNA translation rRNA processing
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
Most questions answered within 3 hours.
-
A resonance tube can be used to measure the speed of sound in
air. A tuning...
asked 1 minute ago -
Lourdes LLC. keeps a $100 change fund in its cash register. At
the end of the...
asked 6 minutes ago -
If the barometric pressure is 107.4 kPa, what is the pressure in
kPa of the gas...
asked 8 minutes ago -
State the operation or control mechanism of TRIAC, DIAC, UJT, PUT,
GTO and IGBT.
asked 9 minutes ago -
Generator An AC generator supplies an rms voltage of 220 V at
50.0 Hz. It is...
asked 11 minutes ago -
Cars enter a car wash at a mean rate of 2 cars per half an hour....
asked 23 minutes ago -
Write SQL queries to answer the following question: A. Which
students are enrolled in Database and...
asked 37 minutes ago -
Required:
How was Dell computer working capital policy as a competitive
advantage? Write at least 200...
asked 19 minutes ago -
Your eye is 2.5 m away from a 60W light bulb that emits light in
all...
asked 26 minutes ago -
As a human and using your own human Intelligent Analysis (IA),
you would have noted that...
asked 28 minutes ago -
Transverse waves on a string have wave speed 8 m/s, amplitude
0.071 m, and wavelength 0.33...
asked 42 minutes ago -
At −11°C a sample of carbon monoxide gas exerts a pressure of
0.45 atm. What is...
asked 42 minutes ago