A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to...
A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to the 3' end of the second intron (introns 2/ exon three splice sites) draw the mRNA strand before and after splicing
Diagram a final functional eukaryotic mRNA molecule from the 5' end to 3' end. There should be 7 items labeled in the diagram.
Homework Answers
The mature eukaryotic mRNA is generated after several complex phenomenons. These include 5' capping, removal of non-coding introns among the coding exons, and 3' poly-A tail addition. The removal of introns is called splicing. During splicing, the exons/introns are selected alternatively and generate variable products of mature mRNA. The phenomenon is called alternative splicing. The alternative splicing is influenced by several splicing activators and repressors that facilitate exons/intron selection during splicing. The detailed answer to the above question is provided as an attachment.
Add Answer to:
A eukaryotic protein-encoding gene has three introns and 4
exons. A splicing repressor commonly binds to...
5. A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon...
5. A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5ʹ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene would be spliced. Indicate which introns and exons would be found in the mRNA after splicing occurs
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
The human protein coding gene frt has three exons. A mutation at the splice junction between...
The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: termination of translation within the coding sequence of the second exon termination of transcription within the coding sequence of the second intron termination of transcription before the coding sequence of the second exon termination...
The human protein coding gene frt has three exons. A mutation at the splice junction between...
The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: O termination of transcription within the coding sequence of the second intron O termination of transcription before the coding sequence of the second exon termination of translation within the coding sequence of the second...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
3. A human gene was initially identified as having three exons and two introns. In order,...
3. A human gene was initially identified as having three exons and two introns. In order, the exons are 456, 224, and 524 bp, while the introns are 2.3 kb and 4.6 kb. a. Draw this gene showing the promoter, introns, exons, and the transcription start and stop sites. b. Surprisingly, it is found that this gene encodes not one but two mRNAs that have only 224 nucleotides in common. The original mRNA is 1204 nucleotides, while the new mRNA...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: termination of translation within the coding sequence of the second exon termination of transcription within the coding sequence of the second intron termination of transcription before the coding sequence of the second exon termination...
The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: O termination of transcription within the coding sequence of the second intron O termination of transcription before the coding sequence of the second exon termination of translation within the coding sequence of the second...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
Most questions answered within 3 hours.
-
The following exchange rates are available to you to buy or
sell.
Mt. Fuji Bank
JPY120.00/USD...
asked 10 minutes ago -
Does smoking hurt the lungs of children’s who are exposed to
adult smoking?
Forced vital capacity...
asked 1 hour ago -
EXPLAIN HOW NEGATIVE AFFECTIVITY IS RELATED TO JOB SATISFACTION.
INCLUDE AN EXAMPLE. MUST BE ANSWERED TWO...
asked 2 hours ago -
On December 31, 2019, Lincoln Inc. sold a used industrial crane
for $660,000 cash. The original...
asked 2 hours ago -
a runner jogs 3.4 miles every morning. how many kilometers does
this represent
asked 3 hours ago -
A 60.80 gram sample of iron (with a heat capacity of 0.450
J/g◦C) is heated to...
asked 3 hours ago -
Question 1 2 pts
The preprocessor executes after the compiler.
False
True
Question 2 2 pts...
asked 4 hours ago -
Explain how a spinal cord injury above C3 could result in a
respiratory arrest
asked 4 hours ago -
You are a statistician and wish to estimate, with 90%
confidence, the proportion of adults who...
asked 7 hours ago -
A man is standing 3.40 m in front of a convex spherical mirror
of radius of...
asked 7 hours ago -
Match the annual percentage rate to each of these trade credit
terms:
__ 1/5, NET 60...
asked 7 hours ago -
ORGANIC CHEMISTRY QUESTION 5
PART A--------
Describe a chemical test for the identification of a double...
asked 11 hours ago