Homework Answers
DNA: 3'TACGGCGACCTT..ca...t...tc...CGCTCGCTT5'
DNA: 5'ATGCCGCTGGAA..gt...a...ag...GCGAGCGAA3'
HnRNA: 5'AUGCCGCUGGAA..gu...a...ag...GCGAGCGAA3'
mRNA: 5'AUGCCGCUGGAAGCGAGCGAA3'
Peptide: Met Pro Leu Glu Ala Ser Glu
Add Answer to:
This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would:...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein....
OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein. You painstakingly derived a segment of the transcribed sequence of this gene, which is listed below. What would be the mRNA sequence that corresponds with this segment? coding 5’ A T G C G T A A T G C T A 3’ template 3’ T A C G C A T T A C G A T 5’ mRNA 5’ A U G...
where does transcription begin 3. List the major types of RNA and include what they code...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
Background Information How can we predict where a coding gene will be in bacteria? And can...
Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
You are given a DNA sequence that codes for a short polypeptide, TACGCTAGGCGATTGACT. What would be...
You are given a DNA sequence that codes for a short polypeptide, TACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? state the amino acid sequence of the polypeptide translated from this mRNA.
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Most questions answered within 3 hours.
-
Delta Airlines
In your opinion, which of the following best characterizes the
purpose of the firm?...
asked 1 minute ago -
Which responsibility centers generate both revenues and
costs?
Question 20 options:
Investment and profit centers
Profit...
asked 49 seconds ago -
Methyl orange is an indicator with a Ka of 1 x 10-4. Its acid
form, HIn,...
asked 2 minutes ago -
What is the pH of a 3% solution of atropine sulfate knowing that
the molecular weight...
asked 2 minutes ago -
In the survey of a random sample of students at a
university, two questions were, “How...
asked 20 minutes ago -
Emily holds a banana of mass m over the edge of a bridge of
height h....
asked 29 minutes ago -
What is the definition of inventory under IFRS? The text gives
several examples of assets that...
asked 22 minutes ago -
A US company X purchased goods from a Belgium based company
worth 800 million Euro. Company...
asked 22 minutes ago -
Be sure to answer all parts.
At 26
°
C, the vapor pressure of water is...
asked 22 minutes ago -
Which organization strategy model would work best for a company
trying to implement an ERP system?...
asked 26 minutes ago -
Fifty university students are randomly chosen from UM-Dearborn
COB. Their physical fitness routines and academic performance...
asked 32 minutes ago -
Calculate pH
part a) [OH-] = 8.9 x 10^-7 M
part b) [OH-] = 7.6 x...
asked 30 minutes ago