Question

describe the production and processing of a protein that will be exported from a eukaryotic cell....

describe the production and processing of a protein that will be exported from a eukaryotic cell. Start with the separation of the mRNA from the DNA template in and with the release of the protein at the plasma membrane.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Protein is a large molecule made from chains of amino acids, which are the subunits of protein molecules. Eukaryotes produce these proteins through a process called protein synthesis. ... Transcription is the process of creating mRNA from DNA, and translation is when ribosomes read the mRNA and synthesize a protein.

Proteins are one of the most abundant organic molecules in living systems and have an incredibly diverse range of functions. Proteins are used to:

  • Build structures within the cell (such as the cytoskeleton)
  • Regulate the production of other proteins by controlling protein synthesis
  • Slide along the cytoskeleton to cause muscle contraction
  • Transport molecules across the cell membrane
  • Speed up chemical reactions (enzymes)
  • Act as toxins

Each cell in a living system may contain thousands of different proteins, each with a unique function. Their structures, like their functions, vary greatly. They are all, however, polymers of amino acids, arranged in a linear sequence

Add a comment
Know the answer?
Add Answer to:
describe the production and processing of a protein that will be exported from a eukaryotic cell....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic...

    Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...

  • Eukaryotic messenger RNA undergoes several processing steps after transcription before it binds to ribosomes as the...

    Eukaryotic messenger RNA undergoes several processing steps after transcription before it binds to ribosomes as the template for protein synthesis. One of these steps is polyadenylation. Identify whether the statements below about polyadenylation are true or false. A polymerase adds a polyadenylate tail of about 10 nucleotides to the 3' end of the mRNA. A polymerase adds a polyadenylate tail to the mRNA while it is still in the nucleus. The polymerase forming the polyadenylate tail uses a polydT DNA...

  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

  • Describe the three events that occur during pre-mRNA processing in eukaryotic cells, including where these processes...

    Describe the three events that occur during pre-mRNA processing in eukaryotic cells, including where these processes take place within the cell.

  • In a eukaryotic cell, if DNA is stored in the nucleus and protein synthesis occurs in...

    In a eukaryotic cell, if DNA is stored in the nucleus and protein synthesis occurs in the cytoplasm, then how does the information in DNA become functional (i.e. processed into protein)?

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • 1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA...

    1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA Poll b) DNA Pol III c) Telomerase d) DNA Gyrase 1.5. Based on what we know regarding gene expression, which of the following basic mechanisms of gene expression is most logical? a) DNA → RN → protein b) DNA → MRNA → protein c) mRNA → DNA → rRNA → protein d) DNA → cell [TURN OVER] 1.6. Which of the following processes does...

  • which layer of outer membranes exist in all eukaryotic cells? none of these cell wall both...

    which layer of outer membranes exist in all eukaryotic cells? none of these cell wall both of these Plasma membrane which of the following is not an organelle of eukaryotic cells? fimbrae cytoskeleton nucleus golgi emerging and reemerging diseases is a challenge facing science? No answer text provided. No answer text provided. true false The smallest unit that is considered to be alive. none of these atoms cell tissues which of the following types of cells have a plasma membrane?...

  • (b)Where in the cell does this process occur? Q3 to create a protein. is the process...

    (b)Where in the cell does this process occur? Q3 to create a protein. is the process in which mRNA is used as a template (b)Where in the cell does this process occur? Q4 carries amino acids to the ribosome for protein synthesis. Q5 Give the complementary DNA sequence to AGGCTATTCATT. Q6 Give the complementary RNA sequence to AGGCTATTCATT. Q7 Use Table 9.4 to give the amino acid sequence that results from the above RNA. Q8 What are two differences betweeen...

  • 4. Describe a reason why there is a constraint on cell size. 1 pt In that...

    4. Describe a reason why there is a constraint on cell size. 1 pt In that context, explain how eukaryotic cells are able to be 10Xlarger than prokaryotic cells. 1 pt 5. Consider a eukaryotic cell making two different proteins: one protein functions within the mitochondria and the other is secreted outside of the cell. The genes encoding the two proteins are transcribed and the two types of mRNA are released into the cytoplasm for translation How will the production...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT