Homework Answers
Add Answer to:
1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA...
DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation. Select all that...
Part A Outline the roles of
double-stranded RNA (dsRNA) in eukaryotic gene regulation. Select
all that apply.
Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation Select all that apply. O dsRNA can inhibit gene expression by inhibition of transcription through heterochromatin formation. O dsRNA can inhibit gene expression by inhibition of transcription through inhibitor synthesis. O dsRNA can inhibit gene expression by destruction of mRNA. O dsRNA can inhibit gene expression by inhibition of replication....
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
can you guys please give me the correct answers and explain why? 9. Which of the...
can you guys please give me the correct answers and explain
why?
9. Which of the following statements is INCORRECT? A. Most human cells contain high levels of telomerase. B. Telomeres protect the ends of eukaryotic chromosomes. C. Telomerase is ribonucleoprotein D. Each round of replication shortens eukaryotic chromosomes. E. Telomerase is an RNA-dependent DNA polymerase. 10. DNA in front of the replication fork is positively supercoiled (over-wound). What is the source of energy required for this over-winding? Pollll Core...
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and...
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and protein? Select the three observations. O DNA plays the major role in replication, which allows for sustainable transfer of genetic information. O RNA is transported out of the nucleus and into the cytoplasm where protein translation occurs. Three types of RNA are found in the cell, and all of them are involved in protein synthesis. O DNA is found in the nucleus and protein...
10. Select all TRUE answers for the following terms. (7 points) DNA Replication (2 points) a....
10. Select all TRUE answers for the following terms. (7 points) DNA Replication (2 points) a. Copies both strands of DNA at the same time. b. Occurs only during S phase of cell cycle. C. Generates RNA from DNA template. d. Necessary for mitosis, but not meiosis. DNA Transcription (2 points) a. Substitutes Guanine (DNA) for Uracil (RNA). b. Produces RNA with complementary sequence to DNA template. C. Generates RNA from both strands of DNA at the same time. d....
1.What is a consensus sequence, and how is this used to initiate the processes of DNA...
1.What is a consensus sequence, and how is this used to initiate the processes of DNA replication, transcription and translation? 2.Outline several mechanisms by which DNA or RNA (especially mRNA) can be protected from degradation and have “extended life”.
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
4. Telomerases... a) are RNA-containing enzymes involved in replicating the ends of linear chromosomes b) cause...
4. Telomerases... a) are RNA-containing enzymes involved in replicating the ends of linear chromosomes b) cause aging in cells c) are structures located at the ends of eukaryotic chromosomes d) are needed by bacteria to complete synthesis of their chromosome ends e) are needed by bacteria to supercoil DNA 5. DNA methylation a) Modifies bases of tRNA molecules, allowing wobble b) Alters the activity of DNA polymerase by affecting access to the DNA c) Is a modification of histone tails...
Part A Outline the roles of
double-stranded RNA (dsRNA) in eukaryotic gene regulation. Select
all that apply.
Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation Select all that apply. O dsRNA can inhibit gene expression by inhibition of transcription through heterochromatin formation. O dsRNA can inhibit gene expression by inhibition of transcription through inhibitor synthesis. O dsRNA can inhibit gene expression by destruction of mRNA. O dsRNA can inhibit gene expression by inhibition of replication....
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
can you guys please give me the correct answers and explain
why?
9. Which of the following statements is INCORRECT? A. Most human cells contain high levels of telomerase. B. Telomeres protect the ends of eukaryotic chromosomes. C. Telomerase is ribonucleoprotein D. Each round of replication shortens eukaryotic chromosomes. E. Telomerase is an RNA-dependent DNA polymerase. 10. DNA in front of the replication fork is positively supercoiled (over-wound). What is the source of energy required for this over-winding? Pollll Core...
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and protein? Select the three observations. O DNA plays the major role in replication, which allows for sustainable transfer of genetic information. O RNA is transported out of the nucleus and into the cytoplasm where protein translation occurs. Three types of RNA are found in the cell, and all of them are involved in protein synthesis. O DNA is found in the nucleus and protein...
10. Select all TRUE answers for the following terms. (7 points) DNA Replication (2 points) a. Copies both strands of DNA at the same time. b. Occurs only during S phase of cell cycle. C. Generates RNA from DNA template. d. Necessary for mitosis, but not meiosis. DNA Transcription (2 points) a. Substitutes Guanine (DNA) for Uracil (RNA). b. Produces RNA with complementary sequence to DNA template. C. Generates RNA from both strands of DNA at the same time. d....
4. Telomerases... a) are RNA-containing enzymes involved in replicating the ends of linear chromosomes b) cause aging in cells c) are structures located at the ends of eukaryotic chromosomes d) are needed by bacteria to complete synthesis of their chromosome ends e) are needed by bacteria to supercoil DNA 5. DNA methylation a) Modifies bases of tRNA molecules, allowing wobble b) Alters the activity of DNA polymerase by affecting access to the DNA c) Is a modification of histone tails...
Most questions answered within 3 hours.
-
One student ran a TLC of an unknown compound on a
silica gel plate and the...
asked 37 seconds ago -
Use inheritance to create a new class AudioRecording
based on Recording class that:
it will retain...
asked 5 minutes ago -
In the long run, an increase in the quantity of money ________
the value of money...
asked 11 minutes ago -
In February 2008, a team of Canadian scientists revealed rare
new horseshoe crab fossils from 445...
asked 17 minutes ago -
a firm produces output according to the following function q=
f(L,K) = L^1/2K^3/2. The cost of...
asked 15 minutes ago -
Please
NO HANDWRITING
NO COPY & PASTE from the internet
On March 6, 2019, Mark Zuckerberg...
asked 16 minutes ago -
Please make a JAVA program for the following using switch
structures
Write a program that simulates...
asked 19 minutes ago -
in
2011, real gdp in the united states was below potential gdp. This
fact definitely means...
asked 21 minutes ago -
Describe how the file manager allocates a file to a single user.
List the steps that...
asked 44 minutes ago -
For the following reaction:
IBr(g) + 4F2(g) → IF5(g) +
BrF3(g)
Compound
ΔH°f (kJ mol-1)...
asked 46 minutes ago -
Assuming the simple probability of even A is given as P(A) and
the simple probability of...
asked 48 minutes ago -
2.- It is known that 20% of the students on campus are smokers.
If 8 students...
asked 49 minutes ago