Given the DNA template strand 3\' CGATGAGCC 5\', write the amino acid sequence in the N-terminal to C-terminal direction. Use the three-letter amino acid abbreviations (for example, Glu-Asp-Val).
Given the DNA template strand 3\' CGATGAGCC 5\', write the amino acid sequence in the N-terminal...
Given the DNA template strand 3" ACCAAACCG 5', write the amino acid sequence in the N-terminal to C-terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid. (for example, Glu-Asp-Val). Refer to a codon table. amino acid sequence:
Given the DNA template strand 3' AACAGACAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid. (for example, Glu‑Asp‑Val). Refer to a codon table.
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino acid sequence (using the three-letter abbreviations) for the resulting dipeptide? Becond GU الا لا 16 First Base BE LE ACC Third Base > COCO لا لا لا | GCA GCG GAG- GGG - Lys-Tyr Phệ-Met His-Glu Lys-Tyr 8 Phe-Met His-Glu Met-His + Change seat Send a message to the instructor < Join another session
Question 5 Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has the molecular formula: Asp, Glu, His, Phe, Val. Partial hydrolysis of the pentapeptide gives: Val Asp, Glu His, Phe Val, and Asp Glu. What is the amino acid sequence of the pentapeptide? 3. When the pentapeptide below is heated first with 2,4-dinitrofluorobenzene...
The NONTEMPLATE strand of a gene includes the following the following sequence: 5'-AACAGCATCACC-3'. What amino acid sequence will be generated when this gene is transcribed and translated?A. N-val-ala-asp-gly-CB. N-gly-asp-ala-val-CC. N-thr-ile-ser-asn-CD. N-pro-leu-arg-gln-CE. N-asn-ser-ile-thr-C
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.