Vasopressin, a nonapeptide hormone secreted by the pituitary gland, functions by stimulating the kidney to retain water. Its sequence was determined by the following evidence: 1. Vasopressin is a cyclic compound containing a disulfide bridge between two cysteine residues. 2. When the disulfide bridge is reduced, vasopressin has the constitution Arg, Asn, Cys2, Gln, Gly, Ile, Phe, Pro. 3. Partial hydrolysis of vasopressin yields seven fragments: Asp-Cys, Ile-Glu, Cys-Phe, Arg-Gly, Phe-Ile-Glu, Glu-Asp-Cys, Cys-Pro-Arg. 4. Gly is the C-terminal group. 5. Both Glu and Asp are present as their side chain amides (Gln and Asn) rather than as free side-chain acids. From the above information, determine the primary sequence of vasopressin and then draw the structure of the Phe-Ile-Glu fragment as it would exist in the intact peptide.
The method of overlapping chains will be used. Information to note from the question is:
· Each amino acid (except Cys) occurs only once in the sequence.
· Gly is C- terminal.
· Glu and Asp obtained during partial hydrolysis = Gln and Asp in the hormone.
Now, the seven chains obtained by partial hydrolysis are :
1. Asp - Cys
2. Ile – Glu
3. Cys – Phe
4. Arg – Gly
5. Phe – Ile - Glu
6. Glu – Asp – Cys
7. Cys – Pro – Arg
Gly is in C terminal. So, the fragment which contains Gly (fragment 4) is the C-terminal fragment.
Thus, we have : - Arg – Gly.
To find who Arg is connected to, look for another fragment with Arg. Fragment 7 has it. So, add 7 to the sequence : -Cys – Pro – Arg – Gly (here, the – before Cys indicates that more fragments will join there since it is the C- terminal sequence)
There are two Cys residues. So, proceeding further would lead to ambiguity. Try to overlap the other chains :
From 5 and 2 we have : Phe – Ile – Glu- . Adding 6 to this : Phe – Ile – Glu – Asp – Cys- .
(Here, the ‘-‘ is on C terminal side since we know that these are not the C-terminal sequences)
The fragment 1 is redundant to the above sequence. Adding 3 to this sequence :
Cys - Phe – Ile – Glu – Asp – Cys- .
Thus, finally, we need to join these two sequences:
Cys - Phe – Ile – Glu – Asp – Cys – and -Cys – Pro – Arg – Gly
Joining, we have : Cys - Phe – Ile – Glu – Asp – Cys – Pro – Arg – Gly
Since Asn and Gln are present as Asp and Glu due to hydrolysis, the primary sequence in the hormone is:
Cys - Phe – Ile – Gln – Asn – Cys – Pro – Arg – Gly
The structure of -Phe-Ile-Glu- as in the peptide is basically : -Phe-Ile-Gln - :
Vasopressin, a nonapeptide hormone secreted by the pituitary gland, functions by stimulating the kidney to retain...
Vasopressin, a nonapeptide hormone secreted by the pituitary gland, functions by stimulating the kidney to retain water. Its sequence was determined by the following evidence: 1. Vasopressin is a cyclic compound containing a disulfide bridge between two cysteine residues. 2. When the disulfide bridge is reduced, vasopressin has the constitution Arg, Asn, Cys2, Gln, Gly, Ile, Phe, Pro. 3. Partial hydrolysis of vasopressin yields seven fragments: Asp-Cys, Ile-Glu, Cys-Phe, Arg-Gly, Phe-Ile-Glu, Glu-Asp-Cys, Cys-Pro-Arg. 4. Gly is the C-terminal group. 5....
I 79) The sequence of a nonapeptide was determined from the following evidence: a. A peptide is acyclic compound containing a disulfide bridge between two cysteine residues. b. When the disulfide bridge is reduced, peptide has the constitution Asn, Cys2, Gin, Gly, Ile, Leu, Pro, Tyr. Partial hydrolysis of reduced peptide yields seven fragments: Asp-Cys, Ile-Glu, Cys-Tyr, Leu-Gly, Tyr-Ile-Glu, Glu-Asp-Cys, and Cys-Pro-Leu. d. Gly is the C-terminal group. C W What is the amino acid sequence of reduced peptide? What...
. Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following dansylated amino acids you expect to observe? A chain Gly-Ile-Val-Glu-Gln-Cys-Cys- Ala-Ser-Val - Cys-Ser-Leu- Tyr-Gln-Leu-Glu-Asn - Tyr-Cys- Asn 10 15 21 B chain Phe-Val - Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu - Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys - Ala 10 20 25 30 15
3. (2 Points) Give the one-letter equivalents for all amino acids in the following sequence and circle the residues most likely to bind to a hard transition-metal ion: Ile-Pro-Arg-Glu-Phe-Glu-Arg-Cys-Ala-Asp-Ile-Ser-Leu-Ile-Lys-Glu-His-Gly
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
1. As we increase our understanding of how proteins fold, we can start making predictions off of the primary amino acid sequence, about how a protein will fold. Use the peptide he answer the following questions: lle-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys- 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-Phe-His-Arg 15 16 17 18 19 20 21 22 23 24 25 26 27 28 a. In the amino acid sequence above, where would you predict that bends or...
please answer all! The dipeptide, Glu-Asn would be most soluble in which solvent system? water and benzene water and sulfuric acid water and butanol water and vinegar (acetic acid) Question 10 Thrombin is an enzyme seen in the blood clotting cascade. It cleaves proteins on the carboxyl side of arginine residues. How many peptide fragments would be formed if Lys-His-Pro-Arg-His was treated with thrombin? Thrombin would not cleave this polypeptide, since there are no arginine residues. 0 1 2 3...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...