Which type of transcription factor would bind to a DNA segment with the following sequence? What is the structure of the DNA binding domain of the protein? What molecular events does binding of the protein promote?
5’ TATATATA 3’
3’ ATATATAT 5’
Transcription factors are the proteins which bind to sepecific region of DNA & initiate and regulate the process of Transcription
The following segment of DNA given in the question contain TATA sequence and Transcription factor which bind to this sequence is one of the Generalized Transcription factor called Transcription factor II D which helps in recruiting polymerase & other transcription factor to core promoter
It is composed of 11 subunit
1 subunit is Tata binding protein ( TBP) which contain beta sheet domain motif and interact at minor groove of DNA
10 subunit are of TBP associated factors TAFs
When this protein bind to TATA sequence the TBP subunit having sheet motif interact to Minor grrove of DNA and bend it to 90o angle which Double stranded DNA to single stranded DNA
And it recruits RNA polymerase and other transcription factors initiating process of Transcription
Plz upvote my answer Thank you?
Which type of transcription factor would bind to a DNA segment with the following sequence? What...
Suppose there is a protein "A" which binds to a DNA sequence and increases transcription of the gene CBC23. In the presence of molecule "C", protein "A" changes structure and can no longer bind to the DNA sequence, resulting in reduced transcription of CBC23. What terms describe "A" and "C" respectively? Enhancer and activator Repressor and Effector Effector and activator Activator and enhancer Polymerase and activator Activator and effector
Which of the following correctly describes eukaryotic transcriptional control? a. A transcription factor is a DNA molecule that helps RNA polymerase to bind to the enhancer of a specific gene. b. An enhancer is a protein that encourages gene expression by binding to the DNA. c. The promoter is the region of RNA where DNA polymerase will bind to begin transcription. d. The interaction of multiple transcription factors may be required in order to transcribe a...
Using a technique called surface plasmon resonance, the on-rate for the transcription factor to bind DNA is measured to be 3.1 ´ 107 M-1 s-1, while the off-rate of the complex is 0.22 s-1. What is the change in standard Gibbs free energy for the binding reaction? (T = 25 °C)
on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the remaining parts. 7. Describe the roles of the following features involved in Eukaryotic transcription: TATA Binding Protein General Transcription Factors Polymerase II 8. In Eukaryotic transcription, which happens first? A. The General Transcription Factors are recruited, and the Preinitiation complex (PIC) is assembled. B. The TBP binds the promoter 9. Describe the carboxy terminal domain (CTD) of RNA polymerase II and two of its...
Nucleosome positioning along the DNA can influence where transcriptional regulatory proteins are able to bind DNA. If a nucleosome is bound to an enhancer sequence, it may outcompete a regulatory protein from binding the same sequence. Conversely, if an enhancer sequence is in the linker DNA where the nucleosome is absent, the regulatory protein does not have to compete with the nucleosome. The position of the nucleosome can alter the accessibility of a sequence of DNA to DNA binding proteins....
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
What are transcription factors? regulatory DNA sequences that bind to the promoter region of a gene regulatory DNA sequences that bind to a protein regulatory motifs that bind to the promoter region of a gene regulatory proteins that bind to specific DNA sequences
What level of protein structure is correct for the general transcription factor TFIID? Consider the follow segment of an mRNA, ggguuaugacgacccccaauaaaggaaacaag... What would be the amino acid sequence? From which human gene is the above mRNA transcribed?
What is an operon? Choose one: A. a short sequence of DNA to which a transcription regulator binds B. a set of genes that is constitutively active C. a sequence of DNA that produces a variety of mRNAs RD. a set of genes controlled by the binding of two or more transcription regulators E. a set of genes transcribed as a single mRNA from a single promoter
Which of the following statements is INCORRECT about enhancers. O A. The location and orientation of the enhancer is non-specific (they are functional regardless of their general location around an within a gene). B. Both activator and repressor proteins can bind to an enhancer. C.Enhancers can only exert their effect in one direction along the DNA. D. Enahncers can bind proteins to affect the architecture (structure) of the DNA. Reset Selection Question 5 of 5 Select all of the following...