Question

Can somebody help me with question 2 and 3?????

Analyse the 300 bp DNA sequence given below to find certain important sequence details on it from a gene function point of view, and certain restriction sites on it, for its physical mapping cloning purposes You may need to use the genetic code (from lecture notes). Address the following activities questions AGCATATCGG CCAATCTCAA ATTTGGGCCC CAAT (Start) ATCATCGTAT TGTTTTTCCTAATGGCCGAAGG HisTyrArg GCCGGCAGCG GATCCGCGCG CTATATACAT CvSTrp SerPhe Glv euProAla TTTTACCCGC le G?VÀrg(Sto AGGCCGIT ATGTCCGAAA CACCACTGAG TACTGTCCGA CTCGGTCAAA TAGCCCAAT AAAAAGC CGCAT TTGCCGGCAT TCTCGAAAGC

Answer 1

2) we have 2 introns and 3 exons in this gene.

intron1 are 50 bp and intron2 are 25 bp long. sequences of introns are marked with brackets in picture below.

null

3) since bacterial genome does not contain introns. so this is a eukaryotic gene sequence.