What is the original postings list of document IDs for the gap sequence in γ-code 1110001110111111010010...
What is the original postings list of document IDs for the gap sequence in γ-code 1110001110111111010010 ?
Homework Answers
The original posting list of document IDs for the gap sequence in y-code of any binary number can known by encoding with several formulae. The given number 1110001110111111010010 would be 3-bit binary number. this can be found using the chain in which the skip pointers are there.The process should be done sequentially to find the original posting list of the document IDs for the gap sequence in y-code.
Add Answer to:
What is the original postings list of document IDs for the gap
sequence in γ-code 1110001110111111010010...
Project 6: Create a double-linked list and traverse the list forward and backward. Document the code...
Project 6: Create a double-linked list and traverse the list forward and backward. Document the code and make sure to include an explanation of how the link list works. If the student adds additional features, he/she should document that as well. In testing the list, show what happens in the case of the NULL list. Show why this type list is easier to search than a single-linked list.
4. The following amino acid sequences list the original sequence and the mutant sequences produced by...
4. The following amino acid sequences list the original sequence and the mutant sequences produced by exposure to the chemical agent SmellyCat, which induces mutations to the DNA. What kind of base change is happening with exposure to SmellyCat? What kinds of structural issues within the DNA could each of these mutations cause? Original: Met-Thr-Asn-Ser Mutant: Met-Asn-Asn-Ser Original: Leu-Asp-Gly-Ser Mutant: Ile-Asp-Gly-Ser Original: Val-Tyr-Cys-Gly Mutant: Val-Tyr
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
28. What is the amino acid sequence that will be produced from this original DNA sequence:...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence?...
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence? Draw Conclusions: a. On the basis of the results obtained by the whole class, do you reject or accept your hypothesis?? b. What can you conclude about the effects of mutations?
Copy and paste the code below into a document. start input myNumber set myAnswer...
Copy and paste the code below into a document. start input myNumber set myAnswer = myNumber / 2 output myAnswer stop Then either: Draw a flowchart or write pseudocode (your choice) to represent the logic of a program that allows the user to enter two values, but CHANGE the program to outputs the product of the two values. (What does "product" mean,, it means to multiply) So, I should see 2 versions: the original I supplied and...
part (C, F ) only. With the java code (write the sequence of method calls as...
part (C, F ) only. With the
java code (write the sequence of method calls as well)
Trees and java code
please provide me your email, ill send the code there
Show how we visualize the binary search tree with root referenced by rootA (page 490) after each of the following changes. Also list the sequence of Binary- SearchTree method calls, both public and private, that would be made when executing the change. Use the original tree to answer each...
9. List some of the reasons why an architecture and a code base inevitably drift apart....
9. List some of the reasons why an architecture and a code base inevitably drift apart. What processes and tools might address this gap? What are their costs and benefits?
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to...
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to code for the sequence of amino acids that make up proteins. Briefly explain what this genetic code is in general and how it works. What is meant by the universality of the genetic code? Explain briefly what the advantages and disadvantages of this type of genetic code are to humans. ANSWER MUST BE ORIGINAL AND NO PLAGIARISM
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Project 6: Create a double-linked list and traverse the list forward and backward. Document the code and make sure to include an explanation of how the link list works. If the student adds additional features, he/she should document that as well. In testing the list, show what happens in the case of the NULL list. Show why this type list is easier to search than a single-linked list.
4. The following amino acid sequences list the original sequence and the mutant sequences produced by exposure to the chemical agent SmellyCat, which induces mutations to the DNA. What kind of base change is happening with exposure to SmellyCat? What kinds of structural issues within the DNA could each of these mutations cause? Original: Met-Thr-Asn-Ser Mutant: Met-Asn-Asn-Ser Original: Leu-Asp-Gly-Ser Mutant: Ile-Asp-Gly-Ser Original: Val-Tyr-Cys-Gly Mutant: Val-Tyr
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence? Draw Conclusions: a. On the basis of the results obtained by the whole class, do you reject or accept your hypothesis?? b. What can you conclude about the effects of mutations?
part (C, F ) only. With the
java code (write the sequence of method calls as well)
Trees and java code
please provide me your email, ill send the code there
Show how we visualize the binary search tree with root referenced by rootA (page 490) after each of the following changes. Also list the sequence of Binary- SearchTree method calls, both public and private, that would be made when executing the change. Use the original tree to answer each...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Most questions answered within 3 hours.
-
A flint glass plate (n = 1.66) rests on the bottom of an
aquarium tank. The...
asked 6 minutes ago -
The position in an object as a function of time is given as ?
(?) =...
asked 21 minutes ago -
Consider a different car. Its initial position at time 5 s is
5m, and it moves...
asked 3 minutes ago -
An electric power station that operates at 25 kV and uses a 20:1
step-up ideal transformer...
asked 5 minutes ago -
Discuss the sales orders process module(s) in the Enterprise
Resource Planning system. How does it contribute...
asked 21 minutes ago -
Which of the eight traits/ skills associated with being an
effective project manager is the most...
asked 5 minutes ago -
In the Metric System, the basic unit of measurement for length
is ___
In the Metric...
asked 12 minutes ago -
A spatially uniform electric field varies in time according
to E = Eo + 3000 t,...
asked 12 minutes ago -
A sample of C3H8 has 1.60×1024 H atoms.
How many carbon atoms does the sample contain?...
asked 18 minutes ago -
Design a class for python named PersonData with the following
member variables:
lastName
firstName
address
city...
asked 35 minutes ago -
How does use of the risk/need/responsivity model impact
effective rehabilitation services?
asked 39 minutes ago -
Your rich uncle has just given you a high school graduation
present of $900,000. The present,...
asked 41 minutes ago