What is the original postings list of document IDs for the gap sequence in γ-code 1110001110111111010010 ?
The original posting list of document IDs for the gap sequence in y-code of any binary number can known by encoding with several formulae. The given number 1110001110111111010010 would be 3-bit binary number. this can be found using the chain in which the skip pointers are there.The process should be done sequentially to find the original posting list of the document IDs for the gap sequence in y-code.
What is the original postings list of document IDs for the gap sequence in γ-code 1110001110111111010010...
Project 6: Create a double-linked list and traverse the list forward and backward. Document the code and make sure to include an explanation of how the link list works. If the student adds additional features, he/she should document that as well. In testing the list, show what happens in the case of the NULL list. Show why this type list is easier to search than a single-linked list.
4. The following amino acid sequences list the original sequence and the mutant sequences produced by exposure to the chemical agent SmellyCat, which induces mutations to the DNA. What kind of base change is happening with exposure to SmellyCat? What kinds of structural issues within the DNA could each of these mutations cause? Original: Met-Thr-Asn-Ser Mutant: Met-Asn-Asn-Ser Original: Leu-Asp-Gly-Ser Mutant: Ile-Asp-Gly-Ser Original: Val-Tyr-Cys-Gly Mutant: Val-Tyr
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence? Draw Conclusions: a. On the basis of the results obtained by the whole class, do you reject or accept your hypothesis?? b. What can you conclude about the effects of mutations?
Copy and paste the code below into a document. start input myNumber set myAnswer = myNumber / 2 output myAnswer stop Then either: Draw a flowchart or write pseudocode (your choice) to represent the logic of a program that allows the user to enter two values, but CHANGE the program to outputs the product of the two values. (What does "product" mean,, it means to multiply) So, I should see 2 versions: the original I supplied and...
part (C, F ) only. With the java code (write the sequence of method calls as well) Trees and java code please provide me your email, ill send the code there Show how we visualize the binary search tree with root referenced by rootA (page 490) after each of the following changes. Also list the sequence of Binary- SearchTree method calls, both public and private, that would be made when executing the change. Use the original tree to answer each...
9. List some of the reasons why an architecture and a code base inevitably drift apart. What processes and tools might address this gap? What are their costs and benefits?
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to code for the sequence of amino acids that make up proteins. Briefly explain what this genetic code is in general and how it works. What is meant by the universality of the genetic code? Explain briefly what the advantages and disadvantages of this type of genetic code are to humans. ANSWER MUST BE ORIGINAL AND NO PLAGIARISM
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....