Genetic Code
The genetic code is what allows the string of nucleotides in our DNA to code for the sequence of amino acids that make up proteins.
ANSWER MUST BE ORIGINAL AND NO PLAGIARISM
Genome or genetic material of an organism is a sequence of nucleotides or DNA in an organism. This DNA contains mainly of the junk DNA which does not code for protein and very less amount is that of the coding DNA.
The non coding region of DNA does not code for any proteins. This region includes the promoter, operator, terminator, enhancer etc.
The coding region of DNA, genetic code, contains the genetic message. It codes for proteins which are the most important players in the activity of a cell and therefore, an organism. Genetic code is read in triplet, each triplet is called codon and codes for one amino acid. This is called specificity of genetic code. One amino acid may have more than one codons, called as degeneracy of genetic code. There are 64 codons for 21 amino acids.There is one start codon (AUG) which codes for methione and three stop codons (UAA, UAG, UGA) which do not code for any amino acid. When a stop codon is encountered translation is terminated. In almost all organisms, every codon codes for the same amino acid. Due to this reason genetic code is said to be universal in nature.
A coding sequence of DNA which is in 5' to 3' direction codes for its complementary template strand which is in direction 3' to 5'. The template strand undergoes transcription and forms mRNA which is complementary to it and is in direction 5' to 3'. This mRNA undergoes translation and codes for amino acids. This is how genetic code works and codes for proteins.
Advantages of genetic code -
Degeneracy - mutation of nucleotide prevents mutation of amino acid so protein gets saved
Wobble hypothesis - one codon is recognized by more than one tRNA so, less energy will be spent in synthesizing tRNA.
Disadvantages of genetic code -
We wont be able to detect silent mutation due to degeneracy.
Insertion and deletion mutation may shift the frame of gene.
Non sense mutation will cause the formation of a stop codon which will lead to premature termination of translation.
Please rate.
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to...
Question 24 (1 point) In regard to the components of the genetic code, a "codon" is a a) polymeric molecule composed of nucleic acids. b) sequence of three nucleotides. c) phosphate group, a ribose sugar, and nitrogen. d) sequence of nucleotides that codes for a protein. Question 25 (1 point) Which one of the following statements concerning protein is not correct? a) Proteins are synthesized in the liver and by B-lymphocytes. b) Proteins are polymers of amino acids. c) An...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 5. If a mutation happens in the DNA that changes the T at base 14 to a G: a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein? b) What is the name of this type of...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain of 200 amino acids of MET-ARG-GLY-(196 more amino acids)-ASN after splicing. A mutation occurs in which the third G is changed to a T. Using the genetic code below, determine which type of mutation this is and briefly explain how translation will be affected for this protein chain.
Lab #14 Protein Synthesis Introduction Proteins are vital for the survival of an organism. Proteins make enzymes and hormones which control reactions that must take place in the cell to survive.Proteins are made of basic units called amino acids. There are a total of 20 amino acids. Different proteins have different number and/or combination of amino acids. The kind of amino acid that is used when producing the protein depends on the 3-base code (codon) read from the RNA molecule...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
QUESTION 11 Meselson and Stahl had obtained the resuk below, what would have been there conclusion First Generation Replication Replication N4 14 NINIS NAS N15 DNA replication is conservative DNA replication is semi-conservative DNA replication is dispersive None of the above QUESTION 12 If one strand of DNA Is CGGTAC in the 5-3 direction, what is the corresponding complementary strand of DNA in the 53' direction? GCCTAG ©GTACG TAACGT GCCATG CATGGA QUESTION 13 Which of the following statements regarding the...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...