Homework Answers
Add Answer to:
4. The following amino acid sequences list the original sequence and the mutant sequences produced by...
28. What is the amino acid sequence that will be produced from this original DNA sequence:...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-I
Which of these protein sequences is most likely to span a cell
membrane?
Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
The NONTEMPLATE strand of a gene includes the following thefollowing sequence: 5'-AACAGCATCACC-3'. What amino acid...
The NONTEMPLATE strand of a gene includes the following the
following sequence: 5'-AACAGCATCACC-3'. What amino acid sequence
will be generated when this gene is transcribed and translated?A. N-val-ala-asp-gly-CB. N-gly-asp-ala-val-CC. N-thr-ile-ser-asn-CD. N-pro-leu-arg-gln-CE. N-asn-ser-ile-thr-C
a) Line up the fragments below so that fragments with the same sequences overlap. Drag each...
a) Line up the fragments below so that fragments with the same sequences overlap. Drag each fragment to the appropriate location. Gly-Val-Tyr Gly-Val-Tyr-Arg Arg-Asn-Tyr Asn-Tyr-Ala-Val-Thr-Cys-Asn-Gln-Lys Ala-Val-Thr-Cys-Asn-Gln-Lys-Trp Trp-Ser Ser continued below... b) Write the sequence of the peptide. Ala-Arg-Asn-Asp-Cys-Gln-Gly-Lys-Pro-Ser-Thr-Trp-Tys
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Which of these protein sequences is most likely to span a cell
membrane?
Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
The NONTEMPLATE strand of a gene includes the following the
following sequence: 5'-AACAGCATCACC-3'. What amino acid sequence
will be generated when this gene is transcribed and translated?A. N-val-ala-asp-gly-CB. N-gly-asp-ala-val-CC. N-thr-ile-ser-asn-CD. N-pro-leu-arg-gln-CE. N-asn-ser-ile-thr-C
a) Line up the fragments below so that fragments with the same sequences overlap. Drag each fragment to the appropriate location. Gly-Val-Tyr Gly-Val-Tyr-Arg Arg-Asn-Tyr Asn-Tyr-Ala-Val-Thr-Cys-Asn-Gln-Lys Ala-Val-Thr-Cys-Asn-Gln-Lys-Trp Trp-Ser Ser continued below... b) Write the sequence of the peptide. Ala-Arg-Asn-Asp-Cys-Gln-Gly-Lys-Pro-Ser-Thr-Trp-Tys
Most questions answered within 3 hours.
-
You and your opponent both roll a fair die. If you both roll the
same number,...
asked 9 minutes ago -
In a study of the accuracy of fast food drive-through orders,
Restaurant A had 257 accurate...
asked 9 minutes ago -
Identify and describe in detail the four categories of
institutions that could be included in a...
asked 15 minutes ago -
In python
class Customer:
def __init__(self, customer_id, last_name, first_name, phone_number, address):
self._customer_id = int(customer_id)
self._last_name =...
asked 22 minutes ago -
What is an example of a limitation in implementing a new
ERP system and how it...
asked 17 minutes ago -
In a section of 9.7cm of an artery with a radius of 2.6mm there
is a...
asked 18 minutes ago -
the two carboxylic acid groups of aspartic acid have different
acidities with pKa values of 2.1...
asked 22 minutes ago -
Would CuCO3 aqueous salt combined with calcium chloride
form a solid precipitate? If so, what would...
asked 21 minutes ago -
How do ECM Solutions assist in embedding a culture of continuous
improvement in an organization? (Project...
asked 42 minutes ago -
Directions
These directions introduce the idea of Essential Questions.
Since this may be a new concept...
asked 44 minutes ago -
1.b. Fiscal policy is said to suffer from ‘crowding out’.
Explain what this means and why...
asked 1 hour ago -
The equation for the reaction of nitrogen and oxygen to form
nitrogen oxide is written as...
asked 1 hour ago