What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide...

Question

Question

What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide insertion O single nucleotide substitution (point mutation) O trinucleotide repeat

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

what tupe Dvf mutatiom iu this? Gniuver option E8] mullotide Tnsextion Nuckotide Insertiomis the addition more oxe nudilotide bare pair into a Dt Seuun e

Add a comment

Answer 2

Similar Homework Help Questions

can i ge thelp changing this to point mutation , insertion , deletion 1) DNA can...

can i ge thelp changing this to point mutation , insertion , deletion 1) DNA can be mutated in one of the three ways. A sample strand of DNA has been provided for you. Select whichever sites are appropriate and show how each type of mutation type would change the DNA by redrawing the newly mutated strand. Also, describe how each mutation changes the protein that is made from the resulting DNA. They are numbered for easy reference. A G...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Question 36 1 pts Chapter 17: What type of mutation is depicted in this illustration? Original...

Question 36 1 pts Chapter 17: What type of mutation is depicted in this illustration? Original sequence T A A с T G C A GG T Point mutation A A G с A G O Substitution Insertion Deletion ОО Frame shift

*Template Strand of DNA 3. The following shows the first portion of a DNA strand of...

*Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start...

Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start codon is position +1. a substitution from G to T in the arginine codon of the antisense stand a substitution of a G nucleotide at position +9 in the antisense strand a transition at position +6 in the sense strand a transversion of A in the histidine codon of the antisense strand a single nucleotide deletion at position +12 in the antisense strand a...
11. Deoxyribose 12. 13. 14. 15. 16. Nucleus Point mutation Deletion mutation Exons Translation Nitrogenous bases...

11. Deoxyribose 12. 13. 14. 15. 16. Nucleus Point mutation Deletion mutation Exons Translation Nitrogenous bases H bonded mRNA A. Molecule that carries instructions for making a protein from a gene in the nucleus to a ribosome in the cytoplasm B. Enzyme that unwinds DNA double helix C. Sugar found in DNA nucleotide D. Process of making a protein E. Substitution of one nucleotide base pair for another F. Rungs (steps) of DNA "ladder" G. Transcription occurs in this part...
Take Test: HW 4 QUESTION 16 What type of mutation leads to frame shift of dna?...

Take Test: HW 4 QUESTION 16 What type of mutation leads to frame shift of dna? O A. Deletion mutation B. Insertion mutation C. Point mutation OD. None

Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide...

Homework Answers

Add Answer to:
What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide...

Post as a guest

Earn Coins

can i ge thelp changing this to point mutation , insertion , deletion 1) DNA can...

A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

Question 36 1 pts Chapter 17: What type of mutation is depicted in this illustration? Original...

*Template Strand of DNA 3. The following shows the first portion of a DNA strand of...

3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start...

11. Deoxyribose 12. 13. 14. 15. 16. Nucleus Point mutation Deletion mutation Exons Translation Nitrogenous bases...

Take Test: HW 4 QUESTION 16 What type of mutation leads to frame shift of dna?...

Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide...

Homework Answers

Add Answer to: What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide...

Post as a guest

Earn Coins

Add Answer to:
What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide...