Homework Answers
Add Answer to:
please help!
Class Participation Q #2 amino acid is formed using following reactions? What the a...
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D....
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
For the following DNA strand, what is the amino acid chain that would result in the cell?
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro
please help with these 5 questions Consider a polypeptide consisting of 19 amino acid residues. Its...
please help with these 5
questions
Consider a polypeptide consisting of 19 amino acid residues. Its structure is shown below. Lys-Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln-Tyr . Draw the fragments that would result if the peptide was treated with trypsin. (No partial credit) . Draw the fragments that would result if the peptide was treated with chymotropsin. (No partial credit) MATCH a term from the list below to each definition. Place the letter of the term in the blank to the left of the definition...
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia...
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia UA Tyrosine (Tyr) UAA Stop codon WA G Stop codon Yad Cysteine (Cys) (UGTA Stop codon (WE ) Tryptophan (Tip) MUG Leucine (Leu) CES Prol CA Histidine (is) EAG Gutamine (G) Arginine (Arg) First base Third base AAAsparagine AAC (Asn) soleucine (llo) Methionine (Met) IACA start codon Threonine (Thr) AG Serine (Ser) AG Arginine (Arg) AUG AAA Lysine (Lys) SAU Aspartic acid GAC (Asp)...
a. Using the table below, predict the secondary structure most likely adopted by the heptapeptide "RANGEHEAL". W...
a. Using the table below, predict the secondary structure most
likely adopted by the heptapeptide "RANGEHEAL". Will it be
alpha-helical, beta-strand, or just random coil?
b. Hydrogen bonds between backbone residues stabilize
interactions between
helixes and
sheets. Knowing this and other information about hydrogen bonds,
which amino acid from the picture below will destabilize secondary
protein structure?
Conformational Preferences of the Amino Acids Preference Amino acid a-helix B-strand Reverse turn Glu 1.59 0.52 1.01 Ala 1.41 0.72 0.82...
C,D, and E i need help with. 17. The following peptide forms part of Human Hemoglobin...
C,D, and E i need help with.
17. The following peptide forms part of Human Hemoglobin subunit gammaa Asp-Leu-Lys-Gly-Thr-Phe-Ala A) Which amino acids are likely to be on the side of peptid acids are likely to be on the side of peptide that faces the interior of the protein? Insert your answer leu, Gto.Pne, Ala B) Which are likely to be facing the aqueous environment? Insert your answer Asp, lys, Thr Draw the structure of the sequence at pH7.4. Using...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...
What kinds of interactions are NOT part of tertiary protein structure? 3 . A) salt bridges...
What kinds of interactions are NOT part of tertiary protein structure? 3 . A) salt bridges In a hydrolysis reaction, B) hydrophilic interactions A. an acid reacts with an alcohol. C) disulfide bonds E. an este reacts with NaOH. C. anester reacts with H.O. D) peptide bonds D. an acid neutralizes a base. E) hydrophobic interactions E. water is added to markene. . All amino acids have chiral Carbon atoms except a. Val 6. Lys C. ASP d. Ala e....
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro
please help with these 5
questions
Consider a polypeptide consisting of 19 amino acid residues. Its structure is shown below. Lys-Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln-Tyr . Draw the fragments that would result if the peptide was treated with trypsin. (No partial credit) . Draw the fragments that would result if the peptide was treated with chymotropsin. (No partial credit) MATCH a term from the list below to each definition. Place the letter of the term in the blank to the left of the definition...
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia UA Tyrosine (Tyr) UAA Stop codon WA G Stop codon Yad Cysteine (Cys) (UGTA Stop codon (WE ) Tryptophan (Tip) MUG Leucine (Leu) CES Prol CA Histidine (is) EAG Gutamine (G) Arginine (Arg) First base Third base AAAsparagine AAC (Asn) soleucine (llo) Methionine (Met) IACA start codon Threonine (Thr) AG Serine (Ser) AG Arginine (Arg) AUG AAA Lysine (Lys) SAU Aspartic acid GAC (Asp)...
a. Using the table below, predict the secondary structure most
likely adopted by the heptapeptide "RANGEHEAL". Will it be
alpha-helical, beta-strand, or just random coil?
b. Hydrogen bonds between backbone residues stabilize
interactions between
helixes and
sheets. Knowing this and other information about hydrogen bonds,
which amino acid from the picture below will destabilize secondary
protein structure?
Conformational Preferences of the Amino Acids Preference Amino acid a-helix B-strand Reverse turn Glu 1.59 0.52 1.01 Ala 1.41 0.72 0.82...
C,D, and E i need help with.
17. The following peptide forms part of Human Hemoglobin subunit gammaa Asp-Leu-Lys-Gly-Thr-Phe-Ala A) Which amino acids are likely to be on the side of peptid acids are likely to be on the side of peptide that faces the interior of the protein? Insert your answer leu, Gto.Pne, Ala B) Which are likely to be facing the aqueous environment? Insert your answer Asp, lys, Thr Draw the structure of the sequence at pH7.4. Using...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...
What kinds of interactions are NOT part of tertiary protein structure? 3 . A) salt bridges In a hydrolysis reaction, B) hydrophilic interactions A. an acid reacts with an alcohol. C) disulfide bonds E. an este reacts with NaOH. C. anester reacts with H.O. D) peptide bonds D. an acid neutralizes a base. E) hydrophobic interactions E. water is added to markene. . All amino acids have chiral Carbon atoms except a. Val 6. Lys C. ASP d. Ala e....
Most questions answered within 3 hours.
-
You are a monopolist and know that your consumers have a linear
demand curve. At what...
asked 3 minutes ago -
Which of the following are true about the strength of the
association between two variables?
1-...
asked 4 minutes ago -
Raising a heavy load requires work. Raising it in half the time
requires:
asked 10 minutes ago -
Calculate the number of valence electrons for
[Mo(C6H6)(CO)3]
asked 8 minutes ago -
MGT-201: Marketing Management
Before deciding on the structure of the channel marketers must
take several factors...
asked 9 minutes ago -
1. ACLs allow a router to control traffic within a network. The
concept is very similar...
asked 11 minutes ago -
35. When the electron in a hydrogen atom falls from its first
excited energy level to...
asked 13 minutes ago -
A man is dragging a box of mass "m" by using a rope which rests
on...
asked 29 minutes ago -
Liquid octane
(CH3(CH2)6CH3) will
react with gaseous oxygen (O2) to produce gaseous carbon
dioxide (CO2) and...
asked 30 minutes ago -
For the reaction N2(g) +
O2(g) --> 2NO(g), if the initial
concentration of NO was 0.00M...
asked 33 minutes ago -
On a recent quiz, the class mean was 75 with a standard
deviation of 2.2. Calculate...
asked 50 minutes ago -
Discuss the Coefficient of Restitution in an elastic collision
compared to the Coefficient of Restitution in...
asked 54 minutes ago