Homework Answers
5)
if deltao > P
then, pairing occur
and low spin complex will form
so,
if deltao > P then low spin complex will form
6)
if deltao < P
then, pairing do not occur
and high spin complex will form
so,
if deltao < P then high spin complex will form
Add Answer to:
Complete the following statements 5. If Δ。> P (pairing energy) then 6. If Δ。< P (pairing...
Which statements are true? Δ?ΔH for an exothermic reaction is positive. When energy is transferred as...
Which statements are true? Δ?ΔH for an exothermic reaction is positive. When energy is transferred as heat from the surroundings to the system, Δ?ΔH is negative. When energy is transferred as heat from the system to the surroundings, Δ?ΔH is negative. The evaporation of water is an exothermic process. Δ?ΔH for an endothermic reaction is positive. A combustion reaction is exothermic.
* la. Calculate the LFSE for [Fe(H20)6]2+ in cm 'given th 10Dq= 16,000 cm-1 P (pairing...
* la. Calculate the LFSE for [Fe(H20)6]2+ in cm 'given th 10Dq= 16,000 cm-1 P (pairing energy)= 18,000 cm-1 (5) * 1b. How would this LFSE-value (determined in the above question) change if the complex were to change spin-states? Does the molecule prefer to be high spin or low spin? Explain (5)
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is...
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. 5 C DNA non-template DNA template mRNA tRNA amino acid Ser C 2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3 3 CGCTACTTTGCGGGCTGCATCCCG 5
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is...
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. DNA non-template DNA template mRNA tRNA amino acid Serc
Τμ. = Σον δ(x – x (1)) = Σ c2P,"P δ(x – x(t)) = Τυμ, (7.19)...
Τμ. = Σον δ(x – x (1)) = Σ c2P,"P δ(x – x(t)) = Τυμ, (7.19) E. η 1 Question 7.1* (i) The energy-momentum tensor of a perfect fluid, with 4-velocity field UM, is given in an arbitrary frame by (7.24), i.e., TW = (€ + P)U"U"/c - Pg. Contract this expression with gu to evaluate T := T" (ii) Show that in a local inertial frame, in which the fluid is at rest, the above energy momentum tensor simplifies...
Problem 6 A bilinear pairing on R2 is given on basis vectors by <ei, ei >=...
Problem 6 A bilinear pairing on R2 is given on basis vectors by <ei, ei >= 13; <ei, e2 >=< e2, ej >= 7; <e2,e2 >= 26 a) [3 pts) Find the matrix representation of the pairing. b) (4 pts) Explain why the bilinear pairing defines an inner product. c) [3 pts) If v = [5 – 3]T, find a non-zero vector w with < v, w >= 0
5. Complete the following statements: Resources of the company are: Debts and obligations of the company...
5. Complete the following statements: Resources of the company are: Debts and obligations of the company are: Owners' claims to company resources are: The costs of providing goods & services are: Amounts earned for selling goods & services are: Cash distributions to stockholders are: The difference between revenues & expenses is: 6. Financial statements are prepared in the follow order: - an
(5%) Problem 14: Answer the following questions about the Heisenberg's uncertainty principle. Δ 2...
(5%) Problem 14: Answer the following questions about the Heisenberg's uncertainty principle. Δ 25% Part (a) Can the de Broglie wavelength of a particle be known precisely? Grade Summary Deductions 0% Potential 100% OYes, regardless of what we know about the position of the particle. O Yes, if its position is completely unknown No, it's impossible. Submissions Attempts remaining: 3 (0% per attempt) detailed view Igive up! Submit Hints: 0 for a deduction. Hints remaining: Feedback: 5% deduction per feedback...
Identify the following compound: C10H10O2: NMR: δ 2.82 (6 H, s), δ 8.13 (4 H, s)...
Identify the following compound: C10H10O2: NMR: δ 2.82 (6 H, s), δ 8.13 (4 H, s) IR: 1681 cm-1, no O-H stretch
8. Indicate whether the following statements are true or false: a. If the free energy,AG,ofareaction is...
8. Indicate whether the following statements are true or false: a. If the free energy,AG,ofareaction is negative, then the entropy,AS,must be positive b. Anendergonicreactionisone forwhichAGispositive. c. Increasing the temperature usually increases the rate of a chemical reaction because it increases rate of movement of molecules d. A reaction that releases heat (ΔH) is termed exothermic, while a reaction that releases free energy, Δ G, is termed exergonic e. The transition state of a reaction is always at a higher (unfavorable)...
* la. Calculate the LFSE for [Fe(H20)6]2+ in cm 'given th 10Dq= 16,000 cm-1 P (pairing energy)= 18,000 cm-1 (5) * 1b. How would this LFSE-value (determined in the above question) change if the complex were to change spin-states? Does the molecule prefer to be high spin or low spin? Explain (5)
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. 5 C DNA non-template DNA template mRNA tRNA amino acid Ser C 2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3 3 CGCTACTTTGCGGGCTGCATCCCG 5
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. DNA non-template DNA template mRNA tRNA amino acid Serc
Τμ. = Σον δ(x – x (1)) = Σ c2P,"P δ(x – x(t)) = Τυμ, (7.19) E. η 1 Question 7.1* (i) The energy-momentum tensor of a perfect fluid, with 4-velocity field UM, is given in an arbitrary frame by (7.24), i.e., TW = (€ + P)U"U"/c - Pg. Contract this expression with gu to evaluate T := T" (ii) Show that in a local inertial frame, in which the fluid is at rest, the above energy momentum tensor simplifies...
Problem 6 A bilinear pairing on R2 is given on basis vectors by <ei, ei >= 13; <ei, e2 >=< e2, ej >= 7; <e2,e2 >= 26 a) [3 pts) Find the matrix representation of the pairing. b) (4 pts) Explain why the bilinear pairing defines an inner product. c) [3 pts) If v = [5 – 3]T, find a non-zero vector w with < v, w >= 0
5. Complete the following statements: Resources of the company are: Debts and obligations of the company are: Owners' claims to company resources are: The costs of providing goods & services are: Amounts earned for selling goods & services are: Cash distributions to stockholders are: The difference between revenues & expenses is: 6. Financial statements are prepared in the follow order: - an
(5%) Problem 14: Answer the following questions about the Heisenberg's uncertainty principle. Δ 25% Part (a) Can the de Broglie wavelength of a particle be known precisely? Grade Summary Deductions 0% Potential 100% OYes, regardless of what we know about the position of the particle. O Yes, if its position is completely unknown No, it's impossible. Submissions Attempts remaining: 3 (0% per attempt) detailed view Igive up! Submit Hints: 0 for a deduction. Hints remaining: Feedback: 5% deduction per feedback...
8. Indicate whether the following statements are true or false: a. If the free energy,AG,ofareaction is negative, then the entropy,AS,must be positive b. Anendergonicreactionisone forwhichAGispositive. c. Increasing the temperature usually increases the rate of a chemical reaction because it increases rate of movement of molecules d. A reaction that releases heat (ΔH) is termed exothermic, while a reaction that releases free energy, Δ G, is termed exergonic e. The transition state of a reaction is always at a higher (unfavorable)...
Most questions answered within 3 hours.
-
Find the complete optimal solution to this linear programming
problem. Max 5x + 3y s.t. 2x...
asked 22 minutes ago -
The pH of an acetate buffer was determined to be 4.76. Then, a
few drops of...
asked 24 minutes ago -
a sample of size 1500 is used to find a confidence
interval for the percentage of...
asked 34 minutes ago -
Explain in detail the differences between qualitative and
quantitative forecasts. Include at least two examples of...
asked 38 minutes ago -
Differentiate between response time and throughput.
Explain how the physical design of a database influences
performance...
asked 40 minutes ago -
Write MATLAB code to plot the following
waveforms.
Rectangular pulses:
????(?)
????(? − ?)
????(?/?) ...
asked 40 minutes ago -
4. Adam’s Inc.’s outstanding common stock is currently selling
in the market for $28. Dividends of...
asked 51 minutes ago -
question
you were
asked to create a regression that will predict the amount of saving
for...
asked 58 minutes ago -
If tcalc = -2.78, tcrit = 1.96, H0: Mu > Mu0, and Xbar <
Mu0, what...
asked 1 hour ago -
Circular distribution
•Suppose two birds are flying, one is flying from the north and
the other...
asked 1 hour ago -
please answer all... it all counts as a discussion problem
1a qualitative data and proportions: Suppose...
asked 1 hour ago -
Typing The Answer Is Mandatory
Temperature is a measure of heat. More heat means that more...
asked 1 hour ago