Homework Answers
Add Answer to:
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is...
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is...
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. 5 C DNA non-template DNA template mRNA tRNA amino acid Ser C 2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3 3 CGCTACTTTGCGGGCTGCATCCCG 5
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions...
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways...
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...
Complete the following table and answer the next two questions (3.5 marts) 10 B I =...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
Question 3 (4 pts): The following table provides just enough information about a section of a...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
10 DN A and RNA: Structure and Function Name Lab section may collect These end-ofesercise questions...
10 DN A and RNA: Structure and Function Name Lab section may collect These end-ofesercise questions so, pleare Aill in your name and kob secin End-of-Exercise Questions Directions: Use the complete codon dictionary (table 10.2) to answer these questions 1. Use the base equence for mRNA to complete the columns on the following table (table 10.4). (Use the mRNA Rememsn the table. Do not use the mRNA hase pair sequence from the exercise you just completed.) sequence shown in the...
2. For the following short segment of a DNA strand, complete the following table. The codon...
2. For the following short segment of a DNA strand, complete the
following table. The codon dictionary is provided for you on the
previous page.
Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. 5 C DNA non-template DNA template mRNA tRNA amino acid Ser C 2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3 3 CGCTACTTTGCGGGCTGCATCCCG 5
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
10 DN A and RNA: Structure and Function Name Lab section may collect These end-ofesercise questions so, pleare Aill in your name and kob secin End-of-Exercise Questions Directions: Use the complete codon dictionary (table 10.2) to answer these questions 1. Use the base equence for mRNA to complete the columns on the following table (table 10.4). (Use the mRNA Rememsn the table. Do not use the mRNA hase pair sequence from the exercise you just completed.) sequence shown in the...
2. For the following short segment of a DNA strand, complete the
following table. The codon dictionary is provided for you on the
previous page.
Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...
Most questions answered within 3 hours.
-
Calculate the equillibrium constent K for a redox reaction that
has E°cell = -.98 V at...
asked 1 minute ago -
3. draw a diagram of the magnetic field:
a. around a long straight wire with a...
asked 1 minute ago -
A concave spherical mirror has a radius of curvature of
magnitude 19.6 cm.
(a) Find the...
asked 2 minutes ago -
If you titrated 30.0 mL of 0.1 M HCl with 0.1 M NaOH, indicate
the approximate...
asked 10 minutes ago -
NADH passes electrons into the electron transport chain. List
the carriers that would receive the electrons,...
asked 18 minutes ago -
A cylindrical cable with a resistivity of 1.6x10-8 Ω·m and cross
sectional area of 3x10-5 m^2...
asked 18 minutes ago -
True or False.
A consumer with convex preferences who is indifferent between
the bundles (5,2) and...
asked 21 minutes ago -
A diamond's index of refraction for red light, 656 nm, is 2.410,
while that for blue...
asked 34 minutes ago -
Compare HPLC, SPE, and GC. Identify the differences, the
advantages, and the weaknesses of each method.
asked 35 minutes ago -
Characteristic x-rays emitted by potassium have a wavelength of
0.374 nm. What is the energy of...
asked 38 minutes ago -
there is a function to create two random numbers between 1 and
25 and a function...
asked 56 minutes ago -
At a certain temperature, the ?pKp for the decomposition of
H2SH2S is 0.832.0.832.
H2S(g)↽−−⇀H2(g)+S(g)H2S(g)↽−−⇀H2(g)+S(g)
Initially, only...
asked 50 minutes ago