20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3’—A T T G C T T A C T T G C A T -- 5’ DNA 5’-- Does it matter which strand is the ‘code strand’? The following two sequences look identical, except one runs 3’-5’ and the other 5’-3’. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3’ and 5’ ends). Use the Universal triplet code to...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA > Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary RNA sequence: Write the 3-letter amino acid sequence: