Homework Answers
The ribosome translate from 5' to 3'. The respective amino acid
sequence is after translation of mRNA is given below:-
Add Answer to:
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this...
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides! TAC AAT ACA ACT
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is...
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. 5 C DNA non-template DNA template mRNA tRNA amino acid Ser C 2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3 3 CGCTACTTTGCGGGCTGCATCCCG 5
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG...
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
1) Based on complementary base pairing and anti-parallelism, complete the following table. Assume this sequence is in the middle of an exon. 5 C DNA non-template DNA template mRNA tRNA amino acid Ser C 2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3 3 CGCTACTTTGCGGGCTGCATCCCG 5
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth
Most questions answered within 3 hours.
-
C - Language
Write a loop that sets each array element to the sum of itself...
asked 30 minutes ago -
(63
#14)
which of the following statments best describes how chamging
the concentration of the substances...
asked 4 hours ago -
In the following reaction, which element is undergoing
oxidation: Na2SO3 + N2O --> N2 + Na2SO4...
asked 4 hours ago -
Which of the following pairs of ions have the same electron
configuration?
I: Br− and Se2−...
asked 7 hours ago -
The Foremost Composite Materials Company is planning a two-day
sales conference for October 19-20. The conference...
asked 7 hours ago -
3) Illustrate the observed pattern of relatedness of organisms
versus adaptations to specific conditions. This means...
asked 8 hours ago -
In winter a lake has a 0.35 m thick ice layer over 1.10 m of
water....
asked 9 hours ago -
Assuming the following has been encrypted with a Vigenere cipher
below, use the method(s) and assumptions...
asked 9 hours ago -
How would I use switch statements to write a program that will
take an input of...
asked 9 hours ago -
Imagine a reaction in which methane gas combusts at a constant
pressure of 1 atm and...
asked 9 hours ago -
Two parallel wires (each 12 m in length) are separated by a
distance of 0.065 m...
asked 9 hours ago -
Suppose there were three masses at the corner of uniform
equilateral triangle. The masses are m1...
asked 9 hours ago