Homework Answers
Answer-
According to the given question-
(1) Here the sequence are given-
5' AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3'
| mRNA Codon | Corresponding Amino acid |
| AUG | MET |
| AUU | ILE |
| UUG | LEU |
| UAC | TYR |
| CCA | PRO |
| GCC | ALA |
| AAA | LYS |
| GAA | GLU |
| GGG | GLY |
| CGA | ARG |
| UGA | STOP CODON |
Question 2- we have to determine the mRNA strand , polypeptide chain from the given DNA Template strand.
DNA Template - 3' TACTTCCCAAAGCGCTACCCGGCAATC 5'
mRNA strand- 5' AUGAAGGGUUUCGCGAUGGGCCGUUAG 3'
POLYPEPTIDE CHAIN- Amino terminal MET- LYS- GLY- PHE- ALA- MET- GLY- ARG- STOP- carboxy terminal.
Question 3- we have to determine the mRNA strand , polypeptide chain , t- RNA Codons from the given DNA Template strand.
DNA Template - 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5'
mRNA strand- 5' AUGGCAAGGAAUGA UGCCAAGAGGGAUAA 3'
t- RNA Anti-codons- 3' UACCGUUCCUUACUAACGGUUCUCCCUAUU 5'
POLYPEPTIDE CHAIN- Amino terminal MET-ALA- ARG-ASN- ASP-SER- GLN-GLU- GLY-STOP- carboxy terminal.
Add Answer to:
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...
QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to...
QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to the 3' end of the mRNA molecule? A. Peptide bond B.5 phosphate group C.3" hydroxyl group D. Amino (N-terminus) E. Carboxyl (C-terminus) QUESTION 14 Which of the following is true regarding pre-mRNA modifications/processing? O A. Alternative splicing allows for increased complexity and synthesis of protein isomers OB. The 5' cap is added after RNA polymerase dissociates from the gene OC. The poly A tail...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided....
Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided. Determine which amino acid is coded for and write its name next to the corresponding number below. ① START - methionine ⑤Click or tap here to enter text. ②Click or tap here to enter text. ⑥Click or tap here to enter text. ③Click or tap here to enter text. ⑦Click or tap here to enter text. ④Click or tap here to enter text. ⑧Click...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...
QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to the 3' end of the mRNA molecule? A. Peptide bond B.5 phosphate group C.3" hydroxyl group D. Amino (N-terminus) E. Carboxyl (C-terminus) QUESTION 14 Which of the following is true regarding pre-mRNA modifications/processing? O A. Alternative splicing allows for increased complexity and synthesis of protein isomers OB. The 5' cap is added after RNA polymerase dissociates from the gene OC. The poly A tail...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Most questions answered within 3 hours.
-
A hawk is flying horizontally at 24.0 m/s in a straight line,
185 m above the...
asked 5 minutes ago -
Draw a Supply and Demand Graph for yourself. Now draw a dashed
line vertically down through...
asked 2 minutes ago -
A 3.15-g bullet embeds itself in a 1.17-kg block, which is
attached to a spring of...
asked 4 minutes ago -
1a. An aqueous solution of calcium hydroxide is
standardized by titration with a 0.116 M solution...
asked 7 minutes ago -
In response to concerns about nutritional contents of fast
foods, McDonald's has announced that it will...
asked 23 minutes ago -
A gun with inertia 5.5 kg fires a 13-g bullet at a stationary
target located 1.0...
asked 24 minutes ago -
A box contains twenty-five screws which are identical in size,
but 13 of which are copper...
asked 27 minutes ago -
“Is it possible that objectively
a product is high quality but subjectively low
quality?”
Please support...
asked 29 minutes ago -
OCHEM LAB
Why does hydration of 2-methyl-3-butyn-2-ol give the ketone,
3-hydroxy-3-methyl-2-butanone (4), rather than the aldehyde,...
asked 38 minutes ago -
A sample of gas at 15 ⁰C and 0.988 atm has a volume of 2.58
liters....
asked 45 minutes ago -
Enzymes are required in retroviruses because the genome
is not used directly as mRNA (T/F)
Please...
asked 44 minutes ago -
An AC generator supplies an rms voltage of 240 V at 50.0 Hz. It
is connected...
asked 56 minutes ago