Homework Answers
Answer=AUG-UUA-CGA-AUA
Explanation-
In mutant 1 AUA(Ilu) changes in to AUG(Met) by transition mutation.
In mutant 2 CGA(Arg) changes in to UGA(STOP Codon) by transition mutation.
In mutant 3 UUA(Leu) changes in to UUC/UUU(Phe) by transversion mutation.
Add Answer to:
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition/transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met - gin-ala - ser-val - arg - phe Mutant 1: met - gln - pro-ser -...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition / transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met – gln – ala – ser – val – arg – phe Mutant 1:...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition/transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met - gin-ala - ser-val - arg - phe Mutant 1: met - gln - pro-ser -...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
Most questions answered within 3 hours.
-
Amazon is not just a
surviving company of the 1990s tech boom; it is now one...
asked 7 minutes ago -
An ANOVA comparing two groups is equivalent to an independent
samples t-test.
True
False
asked 4 minutes ago -
A dock worker applies a constant horizontal force of 75.0 N to a
block of ice...
asked 4 minutes ago -
You are the CEO of a major corporation whose databases were
recently hacked, and sensitive customer...
asked 8 minutes ago -
Q1b. Provide an example of how pricing should interact
with the services offered by the retailer.
asked 35 minutes ago -
a mass weighing 8 pounds when attached to a spring, stretches
it 6 inches.the object is...
asked 42 minutes ago -
The following is part of the computer output from a regression
of monthly returns on Waterworks...
asked 47 minutes ago -
Bob Katz is purchasing a new Honda Pilot for $35,000. He is
financing $30,000 with a...
asked 50 minutes ago -
The equity holders of Super Nova, Inc. have 100 million of
equity in the firm. Because...
asked 49 minutes ago -
A sample of 240 observations is selected from a normal
population with a population standard deviation...
asked 1 hour ago -
Write an (efficient) pseudocode for the implementation of each
of the following function prototypes (proper C...
asked 1 hour ago -
Klingon Widgets, Inc., purchased new cloaking machinery three
years ago for $5.6 million. The machinery can...
asked 1 hour ago