1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read?
2. How are new nucleotide monomers attached to the growing strand? What is the reaction that
takes place? How is dATP different from ATP?
3. Why does the lagging strand exist?
4. In the lagging strand, what is the enzyme that replaces the RNA primer with DNA? What
enzyme then connects the two fragments together?
5. The replication machinery is very accurate but every once in a billion basepairs, a mismatch
occurs. Also, at times DNA can become damaged by environmental factors. Outline the steps
involved in correcting these errors.
6. What is it that exists at the ends of DNA that prevents the erosion of genes during successive
rounds of replication?
7. Describe the details of the above mechanism and how and where telomerase restores the
shortened telomere sequences.
8. When during the cell cycle is DNA replicated? What is the cell getting ready to do if it’s
replicating its DNA?
1. If the template strand sequence is, 3’-TTG CAA TGC AAC-5’ , the new strand or complementary strand sequence is, 5’-AAC GTT ACG TTG-3.’
1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read?...
Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think carefully about this answer! The question in my presentation had a mistake. DNA poll replaces the RNA primer at the 5' end of the new strand with DNA. DNA poll replaces the RNA primer at the 3' end of the new strand with DNA. None of the above Question 4 1 pts Telomerase works by Elongating the 5' to 3' newly replicated DNA strand...
1. DNA Replication (10 Pts.) Create your own strand of dsDNA being sure to indicate 3’ and 5’ ends. Tell me how DNA is replicated including how bases pair. Show me DNA replication using your strand (this can be hand drawn). What enzymes are used to actually make the new DNA? How is the DNA primed for replication? What enzyme is responsible for this? What enzyme removes the primer and fills in the gap with DNA? What enzyme covalently bonds...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
Question 14 1 points Save Answer DNA replication poses several challenges to the cell that must be resolved for replication to proceed. All of the following are cellular solutions to the challenges posed by DNA replication except... O A. Helicase unwinds to the DNA to allow the replication fork to form. O B. Primase synthesizes an RNA primer since DNA polymerase can only extend an existing polynucleotide chain. O C. Higher eukaryotes utilize multiple origins of replication to reduce the...
genetic biology 5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need to extend the short stretch of nucleotides shown on the bottom strand? (b) Write the sequence of the newly synthesized fragment and label its S' and 3' end. (c) The covalent bond between these adjacent nucleotides is what type of chemical bond? After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...