Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
Hello,
I came across this question and I am confused on where to
start.
Restriction mapping...
Module 2 homework Laurel Jacqmain- Assignment Score: 20% Resources Hint Check Answer Question 5 of 5...
Module 2 homework Laurel Jacqmain- Assignment Score: 20% Resources Hint Check Answer Question 5 of 5 > A B C D E Restriction mapping of a linear piece of DNA reveals the EcoRI restriction sites. EcoRI site ! EcoRI site 2 2 kb. 4 kb 5 kb 11 kb 6 kb 5 kb 4 kb --3.5 kb 2 kb In each of the scenarios described, DNA is cut by EcoRI and the resulting fragments are separated by gel electrophoresis. The...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
A plasmid is cleaved by restriction endonucleases and analyzed by agarose gel electrophoresis. Assume there is...
A plasmid is cleaved by restriction endonucleases and analyzed
by agarose gel electrophoresis. Assume there is no supercoiling.
Answer the following three questions about the plasmid.
Can you please help below? I also don't understand it so a
explanation for each would be helpful. For the first one I think
its 1000bp but unsure. For the second, I think there is 2 HindIII
sites and for the last one there is 1 EcoRI site? Please
explain.
A plasmid is cleaved...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
Can someone help me with this homework question on gel electrophoresis? Translocation and deletion 3. You...
Can someone help me with this homework question on gel
electrophoresis?
Translocation and deletion 3. You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in determining whether a patient has a mutation within a specific DNA region. You know that this DNA segment of the "normal" gene does not include an EcoRI restriction site; but the mutated DNA segment of the same gene contains an EcoRI restriction site due to a point mutation at...
You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in...
You PCR amplify a 500 bp (base pairs) piece of DNA that has
diagnostic value in determining whether a patient has a mutation
within a specific DNA region. You know that this DNA segment of the
“normal” gene does not include an EcoRI restriction site; but the
mutated DNA segment of the same gene contains an EcoRI restriction
site due to a point mutation at the 100th bp from the 5’ DNA end.
After PCR amplification, you subject your DNA...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
A linear piece of DNA has the following restrictions sites: You decided to set up an...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
please help if you can 3. You cloned a 20 kb piece of DNA, which contains...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
A colony derived from flask # 2 (with compound B) is used to examine the histidine...
A colony derived from flask # 2 (with compound B) is used to examine the histidine gene. By PCR, a double stranded piece of DNA is made. The PCR product is cleaved with either EcoRI alone, BamHI alone, or with both restriction enzymes simultaneously. Following electrophoresis of the three DNA samples, the following fragment sizes are found: EcoRI: fragments of lengths 3 kb, 5 kb and 14 kb. BamHI: fragments of lengths 7 kb and 15 kb. EcoRI + BamHI:...
Module 2 homework Laurel Jacqmain- Assignment Score: 20% Resources Hint Check Answer Question 5 of 5 > A B C D E Restriction mapping of a linear piece of DNA reveals the EcoRI restriction sites. EcoRI site ! EcoRI site 2 2 kb. 4 kb 5 kb 11 kb 6 kb 5 kb 4 kb --3.5 kb 2 kb In each of the scenarios described, DNA is cut by EcoRI and the resulting fragments are separated by gel electrophoresis. The...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
A plasmid is cleaved by restriction endonucleases and analyzed
by agarose gel electrophoresis. Assume there is no supercoiling.
Answer the following three questions about the plasmid.
Can you please help below? I also don't understand it so a
explanation for each would be helpful. For the first one I think
its 1000bp but unsure. For the second, I think there is 2 HindIII
sites and for the last one there is 1 EcoRI site? Please
explain.
A plasmid is cleaved...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
Can someone help me with this homework question on gel
electrophoresis?
Translocation and deletion 3. You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in determining whether a patient has a mutation within a specific DNA region. You know that this DNA segment of the "normal" gene does not include an EcoRI restriction site; but the mutated DNA segment of the same gene contains an EcoRI restriction site due to a point mutation at...
You PCR amplify a 500 bp (base pairs) piece of DNA that has
diagnostic value in determining whether a patient has a mutation
within a specific DNA region. You know that this DNA segment of the
“normal” gene does not include an EcoRI restriction site; but the
mutated DNA segment of the same gene contains an EcoRI restriction
site due to a point mutation at the 100th bp from the 5’ DNA end.
After PCR amplification, you subject your DNA...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
Most questions answered within 3 hours.
-
An economist wants to estimate the mean per capita income (in
thousands of dollars) for a...
asked 2 minutes ago -
What would be the input/output characteristic of a circuit
obtained by putting two of your 2's-complementers...
asked 1 minute ago -
In Drosophila, the transition from the syncytial blastoderm
stage to the cellular blastoderm stage is a...
asked 30 minutes ago -
Project management question:
Name 3 different types of resources (hint: humans are one
type)
asked 42 minutes ago -
Consider the following reaction: C 2H 2( g) + 2H 2( g) C 2H 6(
g)...
asked 50 minutes ago -
Consider a 1.0 L buffer containing 0.092 mol L-1 HCOOH and 0.100
mol L-1 HCOO-. What...
asked 59 minutes ago -
Koch Realty has owned a vacant land with a FMV of
$775,000 and an adjusted basis...
asked 1 hour ago -
It is estimated 29% of all adults in United States invest in
stocks and that 85%...
asked 1 hour ago -
What does a 2-sided p value of 0.04 mean? (I am not asking if it
is...
asked 1 hour ago -
A parallel-plate capacitor is made from two aluminum-foil
sheets, each 7.8 cmcm wide and 5.1 mmlong....
asked 1 hour ago -
1. why is toluene a stronger nucleophile than benzene?
2.why is phenol a stronger nucleophile than...
asked 1 hour ago -
4. How can you solve for the density of the liquid from the
slope? Please show...
asked 1 hour ago