Homework Answers
The mutated DNA sequence is
3' GAT AA TAC GAG CTT CTC ACT CAT ATA ATC AAA C 5'. The mRNA will be
5' CUA UU AUG CUC GAA GAG UGA GUA UAU UAG UUU 3'. The amino acids will be
Met Glu Glu Glu Stop.
Since translation starts from AUG and stops at stop coodn, so following amino acids will be formed.
Add Answer to:
QUESTION 8 Using the altered mRNA and the genetic code, provide the sequence of amino acids...
Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Most questions answered within 3 hours.
-
Executive Program Practical Connection Assignment
Subject : Operations Security.
Assignment:
Provide a reflection of at least...
asked 4 minutes ago -
Every time Casey is at bat he has a 0.4 probability of
getting on base (assume...
asked 13 minutes ago -
The Walston Company is to be liquidated and has the following
liabilities:
Income taxes
$
9,400...
asked 20 minutes ago -
If
the more comprehensive data is available in MEPS, why does the NHIS
still exist? How...
asked 41 minutes ago -
Koo argues that the Japanese economy in the 1990s suffered from
a balance sheet recession. What...
asked 34 minutes ago -
Automobile mechanics conduct diagnosis tests on 150 new cars of
particular make and model to determine...
asked 28 minutes ago -
11) Find the proceeds of a 5 year non-interest
bearing note for $6500 discounted 2.5 years...
asked 35 minutes ago -
Required: Prepare the consolidated financial statements of
Griffin Ltd at 30 June 2019.
Griffin Ltd is...
asked 44 minutes ago -
1.How large must the coefficient of static friction be between
the tires and the road if...
asked 59 minutes ago -
What is the time complexity (Big-O) of the following code?
class Main
{
// Recursive...
asked 59 minutes ago -
Economists look at any situation in terms of its component
parts: the people making decisions, the...
asked 1 hour ago -
What is a population?
Select one:
a. All of the individual organisms belonging to the same...
asked 1 hour ago