Polyoma viruses generate three types of T antigens from a single gene. The three T antigens...
Polyoma viruses generate three types of T antigens from a single gene. The three T antigens share some amino acid sequences, but other parts are completely different. Explain the mechanism by which this occurs.
Homework Answers
Polyoma viruses tumor antigens (T antigens) commonly target a key enzyme protein phosphatase 2A (PP2A). T antigen is encoded by a conserved domain called LT-stabilization domain (LSD). The three different types of T antigens are produced by alternative translation from alternative translational start sites. Alternative starts bring diversity as well as some commonality in alternatively translated proteins which makes them so unique and different bringing multiplicity of functional proteins (isoforms). Translation othe antigens starts (read) from different parts of the same gene. Other than alternative start of translation alternative splicing is the mechanism to bring resuffling of the aminoacid sequences to bring variation with unique domains.
Add Answer to:
Polyoma viruses generate three types of T antigens from a single
gene. The three T antigens...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...
Nucleic acid molecules have been isolated from seven types of viruses. The base composition of these...
Nucleic acid molecules have been isolated from seven types of viruses. The base composition of these molecules is shown in the table below but the data are incomplete regarding the composition of the nucleic acid, which is given in terms of the percentage of total base composition Virus Type Base 1 2 3 4 5 6 7 T 12 - 20 18 26 23 T 12 18 0 26 0 18 C 38 - 30 26 - 24 28 G...
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heteroz...
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
2.16. Which of the following partial amino acid sequences from a protein whose gene you wish...
2.16. Which of the following partial amino acid sequences from a protein whose gene you wish to clone would be most useful in designing an oligonucleotide probe to screen a cDNA library? (a) Met-Leu-Arg-Leu (b) Met-Trp-Cys-Trp Explain why.
8. (6) There are three common types of point mutations that can affect the coding sequence...
8. (6) There are three common types of point mutations that can affect the coding sequence of proteins. What are these mutations? How do the mutations change the mRNA sequence and consequently the protein? 9. (2) If you were to suggest gene therapy to the family, how you describe what the main goal of this therapy is? 10. (2) Different virus have been used as vectors for gene therapy. Andenoviruses are one example that have been used in humans. What...
Human blood types A, B and O are associated with the carbohydrate antigens A, B and...
Human blood types A, B and O are associated with the carbohydrate antigens A, B and H respectively. A and B antigens are caused by an alteration of H antigen. Normally everyone can synthesize H antigen (a cell surface carbohydrate found on red blood cells and other cell types). Some people make A and/or B transferase(s) which converts the H antigen to an A and/or B antigen respectively. The H antigen is produced by a specific fucosyltransferase encoded by the...
ΦC31 is a type of bacteriophage that infects Streptomyces bacteria. One gene in the bacteriophage genome...
ΦC31 is a type of bacteriophage that infects Streptomyces bacteria. One gene in the bacteriophage genome specifies a recombinase called ΦC31 integrase that works through a mechanism slightly different from that of the recombinase shown in Fig. 6.30. Most importantly, the two target DNA sequences are different from each other. One called attP is 39 base pairs and is found on the circular bacteriophage chromosome, while the other—attB—is 34 base pairs long and is located on the much larger circular...
With respect to genetics, ABO blood types are controlled by a single gene designated I, which...
With respect to genetics, ABO blood types are controlled by a single gene designated I, which has three alleles. The I A allele gives blood type A, I B gives blood type B, and i gives blood type O. The I A and I B alleles are codominant and i allele is recessive to both the I A and I B alleles. Aside from the I alleles, there are two other genes that when mutated affect ABO blood type inheritance....
-Trace the general mechanism by which a signal transduction pathway occurs (i.e. from signaling molecule to response) Describe the two ways in which signaling proteins act as molecular switches -...
-Trace the general mechanism by which a signal transduction pathway occurs (i.e. from signaling molecule to response) Describe the two ways in which signaling proteins act as molecular switches -Which amino acid residues do kinases typically add phosphate groups? Distinguish between the two types of G proteins -What proteins regulate GTP-binding protein (G proteins) in terms of activation and inactivation? - Distinguish between the three main classes of cell surface receptors.
-Trace the general mechanism by which a signal transduction...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...
Nucleic acid molecules have been isolated from seven types of viruses. The base composition of these molecules is shown in the table below but the data are incomplete regarding the composition of the nucleic acid, which is given in terms of the percentage of total base composition Virus Type Base 1 2 3 4 5 6 7 T 12 - 20 18 26 23 T 12 18 0 26 0 18 C 38 - 30 26 - 24 28 G...
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
Human blood types A, B and O are associated with the carbohydrate antigens A, B and H respectively. A and B antigens are caused by an alteration of H antigen. Normally everyone can synthesize H antigen (a cell surface carbohydrate found on red blood cells and other cell types). Some people make A and/or B transferase(s) which converts the H antigen to an A and/or B antigen respectively. The H antigen is produced by a specific fucosyltransferase encoded by the...
-Trace the general mechanism by which a signal transduction pathway occurs (i.e. from signaling molecule to response) Describe the two ways in which signaling proteins act as molecular switches -Which amino acid residues do kinases typically add phosphate groups? Distinguish between the two types of G proteins -What proteins regulate GTP-binding protein (G proteins) in terms of activation and inactivation? - Distinguish between the three main classes of cell surface receptors.
-Trace the general mechanism by which a signal transduction...
Most questions answered within 3 hours.
-
From past history, the scores on a statistics test are normally
distributed with a mean of...
asked 11 minutes ago -
Calculate the gravitational field strength on the highest peak
of Everest (8848 m above the Earth).
asked 11 minutes ago -
the energy value of carbohydrates is 4.0 cal/g. calculate the
energy in 250 g of carbohydrates,...
asked 13 minutes ago -
i
need the summary of this article “Why I Don’t Trust The Video Games
Cause Violence”...
asked 32 minutes ago -
Draw the reactants and products of the following
reaction:
3-ethyl-2-heptene + HOH → 3-ethyl-3-heptanol +
3-ethyl-2-heptanol...
asked 30 minutes ago -
Determine the ratio of adipic acid and butylene glycol that
should be used to obtain a...
asked 39 minutes ago -
Calculate the ratio of the resistance of 11.0 m of aluminum wire
2.5 mm in diameter,...
asked 32 minutes ago -
Kinkaid Co. is incorporated at the beginning of this year and
engages in a number of...
asked 36 minutes ago -
when setting up a simple pendulum, calculate the string length
required for the period to equal...
asked 55 minutes ago -
: A small but very close dense mass of 389 kg is brought close
to a...
asked 55 minutes ago -
Create a class called Hotel. The hotel class will track the
current reservations for your one-room...
asked 1 hour ago -
In space, a 4.0 kg metal ball moving 30 m/s has a head on
collision with...
asked 1 hour ago