Full form of DNA is deoxyribonucleic acid, which contain long chain of nucleotide ( deoxyribose sugar molecule+bases+phosphate group). Bases in DNA may be adenine, guanine, thymine and cytosine. Attachment of base to 1' position of sugar molecule and phosphate group to 5' position.
please rate my answer thankyou.
3. Draw the phosphodiester backbone of a strand of DNA that is three nucleotides long, (You...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points QUESTION 5 Basic...
pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Below is a piece of a DNA strand. a How can you tell this is DNA and not RNA? b Name the two bases shown. e Draw the coroplementary strand. Make sure to show the hydrogen bonding and draw the sugar phosphate bachyone.
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA strand has a 3'-OH that will be used by the DNA polymerase to add nucleotides using the longer DNA strand as a template. You add dATP, SCTP, dTTP, and ddGTP (dideoxy-GTP); and incubate at the DNA polymerase optimum temperature to allow the extension of the smaller DNA strand. Using the symbols below, draw the extended DNA strand (you don't need to draw the template...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...