ZuoTi.Pro
Question

If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. IBased on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <Based on this figure, which lane contains the shortest DNA strand? (assume the anode is at the bottom) O A. Lane G O B. LaneBased on this figure, what is the deduced DNA sequence? (Assuming the bottom of the picture is the anode) O A. 5 CACTCAATCTCNucleotides used to stop DNA synthesis during DNA sequencing differ from normal nucleotides in which position? O A. 1 OB.5The nucleotides that stop replication are referred to as O A. dideoxynucleotides O B. deoxynucleotides O C. anticodons O D. r

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Answers

(1) A. Decrease the ddNTP/dNTP ratio

Explanation:- ddNTP use as a chain terminator because its lack of 3' OH. Due to this it can make phosphodiester bond with the next nucleotide. Hence, decreased concentration of ddNTP to get sequence of a long strand of DNA.

(2) C. The scientist added two different ddNTP to one of the reaction.

Explanation:- Scientist must add a different ddNTP to each tube. As in picture shows Scientist added two different ddNTP to one of the reaction. Its likely seen in G tube.

(3) C. Lane T

Explanation:- DNA is negatively charge, In gel electrophoresis, DNA strand move towards the positive charge Or anode. The smaller DNA move fast than larger DNA strand. So as in picture, we can clearly see that lane T DNA reached first at bottom. So it is a shortest strand.

(4) C. 5' CACTCAATGTCATGCTGCAT 3'

We can easily count the sequence from top to the bottom of the given picture.

(5) D. 3' end

Explanation:- ddNTP is used to stop or terminate DNA synthesis during DNA sequencing and it is lack of 3' OH as compared to normal nucleotide.

(6) A. dideoxynucleotide (ddNTP)

Explanation:- as we discuss above due to the absence of 3' OH in it structure therefore DNA polymerase cannot add nucleotides to these ddNTP. And stop DNA synthesis.

0 0
Add a comment
Know the answer?
Add Answer to:
If you wish to sequence a long strand of DNA in one round of reactions, you...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • 3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix...

    3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix (containing ATP, CTP, dGTP, and dTTP), and ddGTP. In this way, when the DNA polymerase incorporates a nucleotide carrying guanine into the growing DNA strand, it will use sometimes dGTP and sometimes ddGTP. When ddGTP is used, the DNApol will no longer add nucleotides to the DNA strand. For ala3, write below three the possible molecules produced. For b1-b3, consider that you used ddATP...

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • help me answer these- One strand of a section of DNA Isolated from the bacterium E....

    help me answer these- One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...

  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • One of the reactions used in determining the sequence of nucleotides in a strand of DNA...

    One of the reactions used in determining the sequence of nucleotides in a strand of DNA is reaction with hydrazine. Draw curved arrows to show the movement of electrons in this step of the reaction mechanism Arrow-pushing Instructions OREX 30: HA H39 ΝΗ -NH NH HN AN H3C AH A DE +NH CHỊ N NH2 pt pt :A 1pE Sub ARSWE Item attempt remain co search OPPE

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • base pairing Done stand is positively charged and th one strand contains only purind e DNA...

    base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that wind the DNA strands during replication A. helicase B. mucienne E primase D. DNA polymerase 41) The leading and the lasing and differ in that A) the leading strand is synthesized in the same direction is the movement of the replication fork, and the lagring strand is synthesized in the opposite direction B) the leading...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...

    QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT