Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.
Homework Answers
The chemical structure of DNA trimer 5' ACG 3' and its complementary strand is given below. A double bonds with T and C triple bonds with G.
Add Answer to:
Draw the chemical structure of the DNA trimer 5’-ACG-3’
hydrogen-bonded to its complementary strand. Include the...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'- CATAGGA- 3'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'- CATAGGA- 3'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5′–GCTCACG–3′ number of...
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5′–GCTCACG–3′ number of hydrogen bonds between strands: ?
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5′–TCGGGCG–3′ number of...
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5′–TCGGGCG–3′ number of hydrogen bonds between strands:
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCAACGT-3 number of...
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCAACGT-3 number of hydrogen bonds between strands: 19
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5-СТСТАТА-3' Number
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5-СТСТАТА-3' Number
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5\'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5\'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-AGGCCTT-3 Number As...
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-AGGCCTT-3 Number As a result of rotation about six of its bonds, DNA can exist in a variety of forms. Determine whether each of the following images and properties describes the A form, B form, or Z form of DNA. A form B form Z form All antiparallel strands left-handed C-3' of deoxyribose 18.4 A is out of the plane of helix diameter the other ring atoms...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
3. Draw the phosphodiester backbone of a strand of DNA that is three nucleotides long, (You...
3. Draw the phosphodiester backbone of a strand of DNA that is three nucleotides long, (You don't need to draw out the bases, but be sure to show where they would be attached.) 4. Label the 5' and 3' ends of the backbone that you drew.
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'- CATAGGA- 3'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCAACGT-3 number of hydrogen bonds between strands: 19
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5-СТСТАТА-3' Number
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-AGGCCTT-3 Number As a result of rotation about six of its bonds, DNA can exist in a variety of forms. Determine whether each of the following images and properties describes the A form, B form, or Z form of DNA. A form B form Z form All antiparallel strands left-handed C-3' of deoxyribose 18.4 A is out of the plane of helix diameter the other ring atoms...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
3. Draw the phosphodiester backbone of a strand of DNA that is three nucleotides long, (You don't need to draw out the bases, but be sure to show where they would be attached.) 4. Label the 5' and 3' ends of the backbone that you drew.
Most questions answered within 3 hours.
-
without using map
1. Write a C++ program to find out the top 10 words in...
asked 1 minute ago -
A physics major is cooking breakfast when he notices that the
frictional force between the steel...
asked 5 minutes ago -
1)Calculate the percent ionization of a
0.330 M solution of hypochlorous
acid.
% Ionization = %...
asked 3 minutes ago -
A cyclohexane (c-hex) solution is prepared by fully dissolving
9.11g of a newly synthesized organic compound...
asked 11 minutes ago -
SCHEME :-)
[5 marks] Write a procedure called convert that takes as
arguments: a temperature value...
asked 17 minutes ago -
Are
Acetyl CoA and Pyruvate biological molecules that are used to get
ATP energy in aerobic...
asked 18 minutes ago -
Two waves are traveling on a string, one with a wave function,
y1 = 0.05sin(4x -...
asked 25 minutes ago -
Develop an ideal customer profile for three Dell Customer
groups( a supplier, a global business, and...
asked 28 minutes ago -
Suppose, for any future year, the probability its October rain
is more than 3 inches is...
asked 32 minutes ago -
Solve the following systems of linear equations using
substitution 12p + 3q = 15 6q +...
asked 40 minutes ago -
Prof. D went grocery shopping and purchased one dozen eggs and
one pound of flour (all...
asked 47 minutes ago -
If
somehow loop of Henle were removed - that is if the proximal tubule
was connected...
asked 47 minutes ago