Hi there, this is an example for synthetic pyrrole-imidazole polyamides such as DNA‐binding molecules (mimics to natural products netropsin and distamycin). We can designate N-methylpyrrole as Py and N-methylimidazole as Im hydroxypyrrole as Hp amino acids, which will bind their target sequences with exceptionally high affinities. The mechanism of binding involves side-by-side pairing of Py and Im amino acids ( minor groove of DNA ).
Circles with dots represent the lone pairs of N of purines and O of pyrimidines. The polyamide amino acid pairs, the polyamide hairpins could be made by connecting two hairpins turn‐to‐tail (three units of flexible -CH2- groups). This is the reason for inhibition of gene transcription by polyamides.
Py/Im recognize the C–G
Py/Hp recognize the A–T
Py/Py recognize the A–T & T-A
Hp/Py and recognize the T–A
Im/Py recognize the G–C respectively.
Hope this helped you!
Thank You So Much!
Please Rate this answer as you wish.("Thumbs Up")
4. Briefly (one or two sentences) explain why polyamides (shown below) can inhibit gene transcription. (2...
Indicate the variables types for the listed variables below and briefly explain (one or two sentences) why you think that. 1. Government spending on education in a given financial year ($) 2. Gender of G20 Leaders
1. (a) Microorganisms can be used to remove chemical pollutants from the environment. ine gene cluster xyl encodes several enzymes that are involved in degrading toluene, and transcription of these genes is activated when the xylS protein (expressed continuously under a constitutively active promoter p) binds to toluene. Only then can the resulting xyls/toluene complex bind to the pm promoter to activate transcription of the genes in the xyl cluster. By considering the cellular location of the enzymes that degrade...
can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
The sequence of the gene for alcohol dehydrogenase is shown below. AATGCGTTTACCAAGCGTACAGTGTGCAAA Write the complementary strand of nucleic acid that would be synthesized during transcription below the original strand. 2 pts) How many codons are in the alcohol dehydrogenase Rene? (1 pt) How many amino acids would be in the alcohol dehydrogenase enzyme? (1 pt) TRANSLATION 1 codon base pairs (1 pt) 1 codon amino acids (1 pt) 3 base pairs = amino acids (1 pt) A molecule of tRNA...
Which of the following is NOT a function of transcription that requires the activity from subunits of the Core RNA Palymerase? a. RNA polymerase activity that base-pairs and polymerizes nucleotides to make mRNA. b. Helicase activity that unwinds the double-stranded DNA molecule for transcription c. Specific recognition of -35 box and -10 box sites in the promoter region. d. General binding that helps RNA polymerase loosely adhere to DNA, before Transcription begins. Oe. Trick Question. The Core RNA polymerase can...
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
10. Explain why the pH titration curve shown below for the titration of an unknown weak acid with a strong base has two inflection points or "bumps". List the species present in solution at each of the equivalence points. 6 2 8 Volume of Strong Base Added (mL) 11. What are the points A, B and C on the pH titration curve shown in question 10 called? Fill in the blanks in the sentences below for each of the points...
(a) In 4 or 5 sentences, explain why can we expect companies in the private sector (if left alone) to generate pollution? (b) Give one real life specific example of an actual company polluting the environment. Explain what this pollution is and who is hurt by it. (C) When positive externalities exist, a deadweight loss is created. In one or two paragraphs, please explain why a deadweight is created when positive externalities exist and what this deadweight loss represents.
A cell line isolated from a patient shows decreased transcription of the pS2 gene in response to oestrogen. 1) Explain how you would investigate whether all of the key components for the initiation of transcription are recruited to the pS2 promoter in the right order. Include all of the different classes of proteins that you would look for. [15 marks ] 2) Your results demonstrate that although all of the key components are recruited to the promoter of your gene...
1. Explain the following Figure using 5-7 sentences that should include the purpose of LDH gene expression and whether the result shown in the figure was according to the expectation of the experiment. You may write on the blank side of this quiz (8 points) SPECIFIC ACTIVITY OF LDH IN IPTG SUPERNATANT 3.500 3.000 2.500 e 2.000 1.500 1.000 0.500 0.000 9 10 15 25 20 FRACTION NUMBER 2. Describe, in detail, the effect of IPTG on PET-LDH vector containing...