Question

The sequence of the gene for alcohol dehydrogenase is shown below. AATGCGTTTACCAAGCGTACAGTGTGCAAA Write the complementary strand of nucleic acid that would be synthesized during transcription below the original strand. 2 pts) How many codons are in the alcohol dehydrogenase Rene? (1 pt) How many amino acids would be in the alcohol dehydrogenase enzyme? (1 pt) TRANSLATION 1 codon base pairs (1 pt) 1 codon amino acids (1 pt) 3 base pairs = amino acids (1 pt) A molecule of tRNA has a type of molecule on each end. What are these two types of molecules called (2 pts) In one sentence, define the function of tRNA. (2 pts)

Answer 1

Please look in the image for solution:

gene sequence : - AATGc TTT ACCAA G cTACAQ тет 4CAAA * The complementary strand sequence that would be synthesiled in transcription usi 5'uUACGCAAA UG GUU COCAU GUCACA CGUUU 3| - * The number of codons are: 7 - Aug que cqc AUG UCA CAÇ quo u Step codon is not given in sequence . * Amino acids are 7 because each - codon codes one amino acid . Translation I codon = 3 base pair (three) I codon = ? amino acide lone) 3 base pair= I aminoacia. Come) A A-RNA has two ends: I- Anticodon 2- Amino acid t-RNA is also known as transfer RNA. It transfers amino acid from cytoplasm to translati on complex (ribosome)

Please rate.