Ans:
II Best Wishes II
MAT243 Project #3 MAT 243: Discrete Math Structures Project 3 Sequencing Sequences of numbers are a...
Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols create words, and sequences of words create languages, both Human and Computer. While sequences of nucleotides create DNA, which in turn create new sequences of nucleotides called RNA, which in turn creates sequences of amino acids called proteins, which in turn create, among other things, humans that create, among other things, computers. The quest to identify this “Source Code of Life” quickly became the...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
genetic biology 5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need to extend the short stretch of nucleotides shown on the bottom strand? (b) Write the sequence of the newly synthesized fragment and label its S' and 3' end. (c) The covalent bond between these adjacent nucleotides is what type of chemical bond? After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the...
This week, you will start a course project. For this project, you will design and develop a small website for a travel company. You will develop this website across the span of the course, building new project components each week, until you have a live, hosted website at the end of the course. This project is designed to replicate real-life situations where the clients provide only a few of their requirements and expect a prototype to be developed. Scenario Express...
Computer Science 182 Data Structures and Program Design Programming Project #3 – Link List Card Games One of the nice things about Java is it is very easy to do fun things with graphics. The start code provided here will display a deck of cards on the screen and shuffle them. Your mission, is to start with this code and build a card game. Blackjack, poker solitaire, what ever your heart desires. Blackjack is the easiest. Obviously any program you...
Project 1. Dog Door You are asked to create a dog door for a client. You are programming the remote that will do things such as open and close, etc. You must create both the program and write a white paper explaining your design • It should open (saying "The dog door is open.") and close (saying "The dog door is closed.). • It should take into account a dog going outside and coming back in; it should open when...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
do numbers 4-8 4. Given any directory, use the Is command to display: • all files and sub-directories starting with the letter "D" (note do not list anything in any sub-directory) • its immediate sub-directories (sub-directories only, and no other ordinary files) its immediate hidden sub-directories only - take a screenshot (#3-3) that clearly shows the command and the result. 5. Assume that the following files are in the working directory: $ ls intro notesb ref2 section 1 section3 section4b...
here is the data analysis project, please I need an excellent project, it is due 4 hours! Statistics course. GENERAL DESCRIPTION For the data analysis project, you address some questions that interest you with the statistical methodology we learn in MAT 235. You choose the question; you decide how to collect data; you do the analyses. The questions can address almost any topic (although I have veto power), including topics in economics, psychology, sociology, natural science, medicine, public policy, sports,...
Please help ASAP! C ++, linked list, etc. everything for the project is in the link below. https://www.zipshare.com/download/eyJhcmNoaXZlSWQiOiIzZDIyN2UzYi1kNGFhLTRlMzEtYjMzZi00MDhmYzNiMjk3ZGMiLCJlbWFpbCI6Im1pMTQzNEBnbWFpbC5jb20ifQ== You should turn it in by blackboard. Each task should be in a separate unzipped folder named YourLastName_YourFirstInitial_taskN, where N is the task number inside a zipped file named: YourLastName_YourFirstInitial.zip. You may use code you have written previously and you may ask other members of the class questions about the assignment. However, you must do your own assignment; you may not use...