Question

Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols...

Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols create words, and sequences of words create languages, both Human and Computer. While sequences of nucleotides create DNA, which in turn create new sequences of nucleotides called RNA, which in turn creates sequences of amino acids called proteins, which in turn create, among other things, humans that create, among other things, computers. The quest to identify this “Source Code of Life” quickly became the focus of a great deal of science over the years, not to mention computing power. One method involves the use of certain enzymes that break the nucleotide chains at a specific chemical bond, and then analyzing the resulting fragments to determine the original structure. (The actual methods involved are in some ways harder than the problem in the Project, since you do not always know the sequence of the fragments, only their length. And in some ways much easier, since you have some idea of the count of each fragment contained in the original.)

For this Project you will use the given information and a bit of logic to find an RNA sequence. You should not have to do any outside research, but feel free to explore the topic in greater depth. If you do any external research be sure to properly cite your sources. If you work with another student(s), please include their name(s) in the write-up as well. If you use any electronic resources to help you track the possible sequences or perform calculations, name them in the report, and include sample calculations (in the case of something like a spreadsheet) or sample code (in the case of a programming language). You do not need to include the actual, executable program in the report.

Suppose that when an enzyme that breaks RNA chains after each G link is applied to a 12-link chain, the fragments obtained are AC, UG, and ACG. And when an enzyme that breaks RNA chains after a C or U link is applied, the fragments obtained are U, GU, and GAC. Can you determine the entire RNA sequence from these two sets of fragments? If not, why not? Would it help to know exactly how many of each fragment you have?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Total chain length =12

Enzymes used =2

Fragments obtained = 3 +3 =6

Enzyme treatment 1, Breaking after G =AC, UG, ACG  

The entire sequence contains only 2 G's and AC must be the last fragment of the sequence after being cut after a G.

Confirm sequence : _ _ _ _ _ _ _ _ _ GAC.

This sequence GAC should follow either U or AC.

Assumption sequence 1: _ _ _ _ _ _ _ _ UGAC (or)

Assimption sequence 2:  _ _ _ _ _ _ _ACGAC

The fragment UG and ACG can be anywhere within the first 10 bases.

Enzyme treatment 2, Breaking after U/C=U, GU, GAC

The fragment U must be the first fragment of the sequence after being after a U. We also have a fragment UG from enzyme treatment 1.so the first base U should be followed by a G. And from the fragment GU from enzyme treatment 2, the third base should be U.

  UGU _ _ _ _ _ _ GAC

After this we can neglect the assumption sequence 1, and confirm the assumption sequence 2

UGU _ _ _ _ ACGAC

this is the maximum interpretation we can obtain from the given data. The entire RNA sequence cannot be determined. Knowing how many of each fragment is obtained may help to some extent but the basic requirement that should be satisfied is that after treating with an enzyme, all the fragments must account to 12 bases. Only then we can align the sequence of bases.

Add a comment
Know the answer?
Add Answer to:
Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • MAT243 Project #3 MAT 243: Discrete Math Structures Project 3 Sequencing Sequences of numbers are a...

    MAT243 Project #3 MAT 243: Discrete Math Structures Project 3 Sequencing Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols create words, and sequences of words create languages, both Human and Computer. While sequences of nucleotides create DNA, which in turn create new sequences of nucleotides called RNA, which in turn creates sequences of amino acids called proteins, which in turn create, among other things, humans that create, among other things, computers. The...

  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • An important part of consultative selling is the use of questions to uncover the customer's needs. You have planned some of your questions in constructing your SELL Sequences. SELL Sequences...

    An important part of consultative selling is the use of questions to uncover the customer's needs. You have planned some of your questions in constructing your SELL Sequences. SELL Sequences should be contained in your discussion in of the product, marketing plan, and business proposition. Every important sales presentation should contain most - if not all of the presentation mix ingredients. There is a chart in this chapter that looks like a pie chart with a center - exhibit 11.5....

  • Ab 13DNA and RNA xperiment 1: Coding In this experiment, you will model the effects of mutations ...

    Experiment 1 - Coding ab 13DNA and RNA xperiment 1: Coding In this experiment, you will model the effects of mutations on the genetic code. Some mutations cause no structural or functional change to proteins while others can have devastating affects on an organism. Materials Red Beads Yellow Beads Blue Beads Green Beads Procedure: 1. Using the red, blue, yellow and green beads, devise and lay out a three color code for each of the following letters (codon). For example...

  • QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using...

    QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted    QUESTION 2: You are performing a PCR using primers with a sequence perfectly...

  • do numbers 4-8 4. Given any directory, use the Is command to display: • all files...

    do numbers 4-8 4. Given any directory, use the Is command to display: • all files and sub-directories starting with the letter "D" (note do not list anything in any sub-directory) • its immediate sub-directories (sub-directories only, and no other ordinary files) its immediate hidden sub-directories only - take a screenshot (#3-3) that clearly shows the command and the result. 5. Assume that the following files are in the working directory: $ ls intro notesb ref2 section 1 section3 section4b...

  • 1. List some of the various communities to which you belong (organizations, work, hobbies, fields of...

    1. List some of the various communities to which you belong (organizations, work, hobbies, fields of expertise, family). Give examples of some of the behavioral and language characteristics particular to each group? For instance, do you speak to your job supervisor in the same way you speak to your child or your best friend? Why might you interact with members of different communities differently?    2.What are some of your past experiences with writing? Please explain what you like and...

  • My Research Topic: Is On What Is Sustainable Living? Annotated Bibliography: Assignment Description Assignment: Produce an...

    My Research Topic: Is On What Is Sustainable Living? Annotated Bibliography: Assignment Description Assignment: Produce an Annotated Bibliography of five sources that will help you write your research paper Audience Assume you are writing this bibliography for fellow students who share your interest in the topic chosen. Purpose Writing an Annotated Bibliography demonstrates: • Your understanding of the arguments/points raised in the sources chosen • That the sources chosen are reliable representations for your topic Annotated Bibliographies can also serve...

  • help with questions 5 to 10 please PCB 3023L Lab #4 Protocol & Worksheet (30pt) You...

    help with questions 5 to 10 please PCB 3023L Lab #4 Protocol & Worksheet (30pt) You may work in your lab groups durine class. but all written answers must be completed individually in your own words. 1) Using the plasmid map for orientation 1 and the cDNA map as a guide, complete the plasmid map for orientation #2. (4pt) 612 1318 1 - EcoRi EcoRI Xbal ECORV -Xbal- 1662 +Bell EcoRI EcoRV Not FP -- Xhol X 2015 PRSP +...

  • can you just answer 1,3,4 then ? All of 20 hing Med ia 1 The incide...

    can you just answer 1,3,4 then ? All of 20 hing Med ia 1 The incide d together by chemical beads to form long chains, in the same way that ar e made of long chains of simple molecules Unlike carboidrates, however, protein molecules fold pinc h pes are for their higical function. The folded structure of a protein depends on the sequence of the amino acid building block that forms the polymer chain. A folded protein is shown on...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT