Which of the following is the process of copying the genome? *
DNA replication
conjugation
translation
transcription
OPTION A - DNA REPLICATION
DNA replication is the process by which DNA makes a copy of itself during cell division.The separation of the two single strands of DNA creates a 'Y' shape called a replication 'fork'. The two separated strands will act as templates for making the new strands of DNA.
Bacterial conjugation is the transfer of genetic material between bacterial cells by direct cell-to-cell contact or by a bridge-like connection between two cells.
Trancription is a process in which a particular segment of DNA is copied into RNA by the enzyme RNA polymerase.
Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis.
Which of the following is the process of copying the genome? * DNA replication conjugation translation...
Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate, primer, RNA polymerase, nucleoside triphosphate, transfer RNA, ribosome, messenger RNA , promoter, ribosomal RNA
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what’s provided here). Key players Replication Transcription Translation DNA components RNA components Protein components
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Make a concept map linking the following terms : transciption , translation, genome, gene, protein, genotype, phenotype, replication, DNA, RNA, reverse transcriptase, helicase, ligase , DNA polymerase, RNA polymerase, primase, intron, exon, exome please help and be clear ! Try to make a concept map linking the following terms: if you do not know what a concept map is go to https://www.youtube.com/watch?v=vuBL16ijHHg transcription translation - Ribotone, where translation takes place genome gene - small pice of Drun Inal codes prote....
Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means the cellular process that must occur immediately before the one in the question. synthesis and secretion of insulin from the liver meiosis of spermatogonia production of LH mRNA in the pituitary gland mitosis of intestinal epithelial cells synthesis of steroid hormone receptors
Which of the following is NOT true about bacterial conjugation An F factor drives replication and transfer of a conjugative plasmid The genome of the bacterial chromosome in the donor cells is altered through ectopic recombination Transfer is mediated by a tube-like pilus formed between the adjacent cells Mating cells often break apart before transfer of the entire bacterial chromosome. The transferred DNA can be incorporated in the recipient cell bacterial chromosome via homologous recombination.
A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication fork, DNA polymerase III, primase, and ligation. Make sure that your answer is complete and that all the entities that come together in the process of lagging strand replication are clearly explained. Draw one figure of a replication fork with the polarity (directionality) of each DNA strand indicated. G) Explain RNA transcription in E. coli in detail, from initiation to termination. Underline the following...
AS Part A Which of the following events occurs during DNA replication? All methylation of the DNA is lost at the first round of replication Methylated DNA is copied in the cytoplasm, and unmethylated DNA is copied in the nucleus Methylation of the DNA is maintained because DNA polymerase directly incorporates methylated nucleotides into the new strand opposite any methylated nucleotides in the template. Methylation of the DNA is maintained because methylation enzymes act at DNA sites where ane strand...