Question

In a eukaryote, what modifications are made to mRNA before it is ready for export from the nucleus and subsequent translation
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

In Eukaryotes, mRNA undergoes following types of modification before being exported out of nucleus for translation.

Upon transcription before maturation, mRNA is called pre-mRNA. pre-mRNA goes through the following process to become matured mRNA.

1). Capping: Addition of 7-methylguanosine to the 5' terminus of the pre-mRNA. This helps mRNA to attach with ribosome during translation.

2). poly-A tail : Addition of 100-200 adenine molecules to the 3' terminus of the pre-mRNA. This helps to increase the stability of mRNA transcript and helps it to be exported out.

3). Splicing : Mechanism by which the introns are removed and exons are joined together. pre-mRNA has both introns(non-coding or junk sequences) and exon (coding sequence). In order to be exported out, introns should be removed. This is done by this process called splicing. (Alternative splicing, which exists in a few cases is a process which helps to make different mRNA transcripts from same pre-mRNA.)

Once all the above modifications are done, pre-mRNA is then matured into an mRNA and can be exported out of nucleus for translation.

Add a comment
Know the answer?
Add Answer to:
In a eukaryote, what modifications are made to mRNA before it is ready for export from...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • not sure what the correct answers are To be export-ready, an mRNA molecule must: have its...

    not sure what the correct answers are To be export-ready, an mRNA molecule must: have its 5' cap removed be bound by EJCS have its poly-A tail removed have at least half of its introns removed od 80e covou The extension temperature used during PCR is determined by: the length of the PCR product you want to generate the DNA polymerase that is being used the annealing temperature of your primers x the source of your template DNA (eg, genomic...

  • -Stages of transcription (in detail for each step) - what components are required -Modifications of RNA...

    -Stages of transcription (in detail for each step) - what components are required -Modifications of RNA (on the ends of mRNA, on the interior of mRNA) -why are these modifications important? -Ways to cut out introns (i.e. Splicesomes) -Alternative splicing Translation -TRNA structure and function -What controls accurate translation -wobble effect of tRNAS -general concept of how translation works using mRNA, ribosome, anticodon, tRNA -3 stages of translation (in detail) -initiation -elongation -termination

  • What modifications occur in eukaryotic mRNA? In t-RNA? In r RNA?

    What modifications occur in eukaryotic mRNA? In t-RNA? In r RNA?

  • The main differences in gene expression between prokaryotes and eukaryotes result from the presence of a...

    The main differences in gene expression between prokaryotes and eukaryotes result from the presence of a nucleus in eukaryotes. Which of the following is FALSE when comparing transcription between prokaryotes and eukaryotes? Prokaryotic mRNA goes through multiple modifications before translation Eukaryotic genes have introns that need to be removed before translation Prokaryotic mRNA can be translated while it is still being transcribed Eukaryotic mRNA needs a 'cap and a 3'tall to prevent its degradation 0/2 pts Question 45 Lets play...

  • Question 19 (3 points) Saved Choose all of the modifications to mRNA in eukaryotes. 5' methyl...

    Question 19 (3 points) Saved Choose all of the modifications to mRNA in eukaryotes. 5' methyl G cap splicing endonuclease 3' poly A tail exonuclease Question 21 (4 points) ✓ Saved Please put the following activities of translation initiation in order from first to last. 2 tRNA with anticodon UAC binds to mRNA codon AUG large subunit of ribosome binds to mRNA Small subunit of ribosome binds to mRNA 1 v A-site is open 3 Choose all the molecules that...

  • What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a....

    What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...

  • 1 pts DI Question 6 What region of this molecule shown would bind to mRNA during...

    1 pts DI Question 6 What region of this molecule shown would bind to mRNA during translation? 3' A-OH 5' A Cacceptor stem G C G- U TuC loop D-loop C U GACAC m'A GGAGAGm m' G C-G A-U variable loop Anticodon loop Cm U A Gm A A The 5' end The anticodon loop The 3 end The variable loop The acceptor stem D Question 7 1 pts What is synthesized during transcription? O a strand of tRNA O...

  • CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from...

    CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many reading frames are in that mRNA? 3. How many open reading frames are in that mRNA and what is it/are they? 4. Translate the open reading frame(s).

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • 6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...

    6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT