What modifications occur in eukaryotic mRNA? In t-RNA? In r RNA?
Answer
m (messenger) - RNA modifications:
r (ribosomal)- RNA modifications:
t- RNA modifications:
Hope it will helpful to you. Thank you
All the best
There are several changes that occur to pre-mRNA in eukaryotic cells to produce the final mRNA molecule that will be used in translation. This process is called RNA processing. Which of the following occurs in the process of producing this final mRNA molecule? a poly-A tail is added to the 5' end a modified guanine nucleotide is added to the 3' end the introns are cut out and the exons are attached to each other none of the above
Part A What is the type of each eukaryotic protein that primarily transcribes mRNA, RNA, and rRNA, respectively? O RNA Polymerase I, III, II O RNA Polymerase II, I, III O RNA Polymerase I, II, III RNA Polymerase II, III, I O RNA Polymerase III, II, I Submit Request Answer Provide Feedback
Describe the features present in a mature eukaryotic messenger RNA (mRNA) and discuss how they facilitate translation initiation
-Stages of transcription (in detail for each step) - what components are required -Modifications of RNA (on the ends of mRNA, on the interior of mRNA) -why are these modifications important? -Ways to cut out introns (i.e. Splicesomes) -Alternative splicing Translation -TRNA structure and function -What controls accurate translation -wobble effect of tRNAS -general concept of how translation works using mRNA, ribosome, anticodon, tRNA -3 stages of translation (in detail) -initiation -elongation -termination
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that renders that polymerase non-functional. Match each RNA polymerase mutation with all of the cellular processes that it would disrupt. Mutation in eukaryotic RNA polymerase I Mutation in eukaryotic RNA polymerase II Mutation in eukaryotic RNA polymerase III pre-mRNA processing RNA synthesispre-mRNA synthesis RNAi-mediated gene regulation IRNA synthesis mRNA translation rRNA processing
Shown below is a eukaryotic pre-mRNA that has not undergone any processing. Exons are in blue and introns in red. 5 - CAUUGACCAUGGUCGGAAUGCCGACUGACCUCUAAGGCU - 3' Write (type) out what this pre-mRNA would look like when fully mature with all post-transcriptional modifications completed TT T Arial ✓ 3 (12pt) T Words:0 Path:p
Eukaryotic messenger RNA undergoes several processing steps after transcription before it binds to ribosomes as the template for protein synthesis. One of these steps is polyadenylation. Identify whether the statements below about polyadenylation are true or false. A polymerase adds a polyadenylate tail of about 10 nucleotides to the 3' end of the mRNA. A polymerase adds a polyadenylate tail to the mRNA while it is still in the nucleus. The polymerase forming the polyadenylate tail uses a polydT DNA...
37. Compared to bacterial mRNA, eukaryotic mRNA needs an additional maturation processing by which ___ is removed such that the resulting mRNA contains only exons. This process is called RNA Select one: a. capping reverse transcription b.intron reverse transcription c. transposonsplicing d. intron splicing e. transposons recombination
Describe the three events that occur during pre-mRNA processing in eukaryotic cells, including where these processes take place within the cell.
Compared to bacterial mRNA, eukaryotic mRNA needs an additional maturation processing by which ____ is removed such that the resulting mRNA contains only exons. This process is called RNA ___. Select one: a. capping ;;; reverse transcription b. intron ;;; reverse transcription c. transposon ;;; splicing d. intron ;;; splicing e. transposon ;;; recombination