Describe the features present in a mature eukaryotic messenger RNA (mRNA) and discuss how they facilitate translation initiation
Eukaryotic mRNA are mostly monocistronic ,having an average size of 1500 to 2000 nucleotides. It has 5 end cap, which is recognized by small ribosomal subunit. Eukaryotic mRNA molecules often require extensive processing and transport.
The intitiator tRNA s called tRNAiMet. In the process of initiation,initiation factors eIF2 and eIF3 bind to the 40S ribosomal subunit. In GTP bound form(eIF2 GTP) it binds to tRNAiMet, called ternary complex. Binding of eIF3 and ternary complex with 40S ribosomal subunit gives 43S initiation complex.This complex is independent of presence of mRNA. Initiation factor eIF4F bnds to mRNA. eIF4F s a heterotrimer consisting of eIF4E,eIF4G,eIF4A. eIF4E acts as scaffold protein,which links other components of initiation complex. eIF4A acts as helicase that unwinds any secondary structure at the 5 end. Subsequently,factors eIF4B joins eIF4F- mRNA complex. the eIF4F- mRNA-eIF4B complex join 43S initiation complex through protein protein interaction.
43S initiation complex then translocates along mRNA ,an ATP dependent process called scanning ,until it encounter the AUG initiation codon.it is assisted by factor eIF1 and eIF1A.the small subunit stops when it reaches the initiation site and form 48S complex. eIF5 or eIF5A, a GTPase activating protein,joins the growing assembly. It induce GTP hydrolysis by eIF2. Hydrolysis cause the release of factors eIF2 and eIF3. finally the factors eIF5B enable the 60S subunit to join the complex.Before eIF2 can participate in another round of initiation , its bound GDP must be replaced with a GTP. This process is catalyzed by eIF2B,a guanine nucleotide exchange factor(GEF).
Describe the features present in a mature eukaryotic messenger RNA (mRNA) and discuss how they facilitate...
1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the correct start codon and what proteins are involved in the process? please include the shine-dalgarno sequence in the answer. 2. Consider the following partial sequence of messenger RNA. The sequence below contains the code for a short, complete protein. 5 ́-UCCCCAGUCAUGGAGUCGUUAAUUAAAUGACCGGUGCGGAUCGUA - 3 ́ Using the codon chart (from your textbook or in the lecture slides), give the amino acid sequence of the protein...
Describe the main features of an eukaryotic RNA Polymerase II complex with all 12 subunits identified from the crystal structure, and the function of each feature. ) Describe the main features of an eukaryotic RNA Polymerase II complex with all 12 subunits identified from the crystal structure, and the function of each feature.
Eukaryotic messenger RNA undergoes several processing steps after transcription before it binds to ribosomes as the template for protein synthesis. One of these steps is polyadenylation. Identify whether the statements below about polyadenylation are true or false. A polymerase adds a polyadenylate tail of about 10 nucleotides to the 3' end of the mRNA. A polymerase adds a polyadenylate tail to the mRNA while it is still in the nucleus. The polymerase forming the polyadenylate tail uses a polydT DNA...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
A promotor is used by RNA polymerase during which stage of transcription? Group of answer choices A. Initiation B. Elongation C. Termination D. Promotion 2. In eukaryotic cells, mRNA is modified in several ways. Match the mRNA modifications to their functions. Group of answer choices [ Choose ] Portions of the mRNA that are removed before translation. Helps ribosomes attach to the mRNA. Depending on the length, this structure can help...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
1.Describe and compare eukaryotic and prokaryotic flagella. 2.Describe post-translational and cotranslational transport. 3.Describe prokaryotic mRNA translation in detail, including all steps from start to finish, including all factors. 4.Describe the molecular events involved in regulation of the lac operon in response to both glucose and lactose levels, and transcript (mRNA) abundance regulation in the prokaryotic trp operon including attenuation. 5.Completely describe transcript (mRNA) abundance regulation in the prokaryotic trp operon, and discuss whether or not the attenuation mechanism of transcriptional...
3. Describe RNA processing in eukaryotes. That is, how does a ‘primary transcript’ become a mature mRNA? 4. Imagine a bacterial gene that is necessary for the synthesis of a vitamin needed by the cell. This vitamin is a ‘small molecule’ that can bind to the repressor of this gene. Do you think this binding will increase or decrease the ability of the repressor to bind to the operator of this gene? Why?
Discuss major components and events in RNA processing, including introns and exons, splicing, the spliceosome, the 5'G-cap, and poly(A) tail. Describe tRNA structure and function, including how amino acids are attached to tRNAs and how codons are read. Discuss mechanisms for translation initiation, elongation, and termination.
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....