In your own words, how do chromatin modifications regulate transcription? What modifications are observed in regions of the genome that are being actively transcribed? In regions that are not actively transcribed?
Chromatin structure is highly complex and impressively dynamic.
Scientists now realize that the nucleosome, which was once thought
to be static, actually plays an integral role in directing some
elements of transcriptional specification. A nucleosome core
particle consists of eight histone proteins (two each of H2A, H2B,
H3 and H4) and 146 base pairs of double-stranded DNA. The
composition of nucleosomes is not set in stone, however. Indeed,
canonical histones can themselves be replaced by histone variants
or modified by specific enzymes, thereby making the surrounding DNA
more or less accessible to the transcriptional machinery.
So far, a number of histone variants have been found and localized
to specific areas of chromatin. For instance, H2A.Z is a variant of
H2A and is often enriched near relatively inactive gene promoters.
Interestingly, H2A.Z does not take its place during replication
when the chromatin structure is established. Instead, the chromatin
remodeling complex SWR1 catalyzes an ATP-dependent exchange of H2A
in the nucleosome for H2A.Z (Wu et al., 2005).
CENP-A is another known histone variant that has been found to be
associated with centromeres. Originally localized to the centromere
through immunofluorescence studies, CENP-A was believed to be
involved in centromeric activity during cell division. But, once
the CENP-A protein was isolated and sequenced, it was shown to have
sequence homology to H3, suggesting that CENP-A actually replaces
canonical H3 near the centromere. Some experiments suggest that
these variant histones that occur in particular areas of the genome
may assist in the specific regulation of chromatin behavior and
gene transcription from these areas (Li et al., 2005)
Histone Modification and the Histone Code
Histone sequences are highly conserved. A typical chromatin fiber,
with the blue cylinders representing histones. Extending from each
of the histones is a "tail," called the N-terminal tail because
proteins have two ends--an N terminus and C terminus. Here, the C
terminus forms a globular domain that is packaged into the
nucleosome. The other end of the histone is more flexible and
capable of interacting more directly with DNA and the different
proteins within the nucleus. Specifically, histone modification
involves covalent bonding of various functional groups to the free
nitrogens in the R-groups of lysines in the N-terminal tail. Early
research has linked differing levels of acetylation and methylation
on the histones to altered rates of DNA transcription (Turner,
2005). While the most common additions are acetylation and
methylation of lysine residues, many more types of modifications
have also been observed, including phosphorylation, a common
posttranslational modification. The different types of
modifications, which have been called the "histone code," are put
in place by a variety of different enzymes, many of which have yet
to be fully characterized. Thus, the story of the remodeling
machinery continues to be told through a variety of experiments,
and much remains to be revealed.
Nucleosome Positioning and Reorganization
Because eukaryotic DNA is tightly wrapped around nucleosomes and
the positive charges of the histones tightly bind the negative
charges of the DNA, nucleosomes essentially act as a physical
barrier to transcription factors that need to bind to certain
regions of DNA. However, specific acetylations can remove the
positive charge on the lysine amino group that is acetylated, so
the nucleosome "loses its grip" on the DNA. This modification
results in a loosening of the coil.
Other remodeling enzyme complexes actually slide the nucleosomes
along the DNA to clear them from the promoter regions (Cosgrove et
al., 2004). In this case, the remodeling enzymes use the energy
from ATP to regulate nucleosome movement. For example, prior to
transcription in yeast, one of the major types of chromatin
remodeling machines, called the SWI/SNF and SAGA histone acetylase
complex, is recruited to the yeast HO gene promoter by the SWI5
activator. Activator-dependent chromatin modification then moves
the nucleosome out of the way so that RNA polymerase II can reach
the promoter regions of the DNA (Struhl, 1999).
Chromatin remodeling activity by SWI/SNF or other remodeling
machines can also be required for recruiting additional chromatin
remodeling activity to the site, as well as additional downstream
sites. Modifications at a promoter can occur in multiple steps that
are independently regulated, and additional modifications can occur
stepwise stretching from the point of the first modification along
the DNA strand in a downstream direction toward the promoter. These
modifications open up an elongated region of active chromatin and
allow for a wide range of intermediate, transcriptionally inactive
states for the eukaryotic promoter. Promoters can also be poised
with RNA polymerase bound but not elongating the mRNA; in yeast, up
to 15% of sites have such stalled transcription. Changes in gene
expression during the specific developmental stages of an organism
or cell coincide with fluctuations in the levels of each of the
specific protein complexes involved in chromatin remodeling
(Struhl, 1999).
TRANSRIPTION OF NAKED DNA
The principles and mechanisms underlying transcription on naked DNA
are remarkably similar between eukaryotes and prokaryotes despite
the increased complexity of eukaryotic transcription machinery
(Hahn, 2004). The typical RNA polymerase II (Pol II) transcription
cycle begins with the binding of activators upstream of the core
promoter (including the TATA box and transcription start site).
This event leads to the recruitment of the adaptor complexes such
as SAGA (Green, 2005) or mediator, both of which in turn facilitate
binding of general transcription factors (GTFs; Thomas and Chiang,
2006). Pol II is positioned at the core promoter by a combination
of TFIID, TFIIA, and TFIIB to form the closed form of the
preinitiation complex (PIC). TFIIH then melts 11–15 bp of DNA in
order to position the single-strand template in the Pol II cleft
(open complex) to initiate RNA synthesis. The carboxy-terminal
domain (CTD) of Pol II is phosphorylated by the TFIIH subunit
during the first 30 bp of transcription and loses its contacts with
GTFs before it proceeds onto the elongation stage. Meanwhile, the
phosphorylated CTD begins to recruit the factors that are important
for productive elongation and mRNA processing (Buratowski,
2003).
Histone Modifications and Transcription
Both histone tails and globular domains are subject to a vast array
of posttranslational modifications. These modifications include
methylation of arginine (R) residues; methylation, acetylation,
ubiquitination, ADP-ribosylation, and sumolation of lysines (K);
and phosphorylation of serines and threonines. Modifications that
are associated with active transcription, such as acetylation of
histone 3 and histone 4 (H3 and H4) or di- or trimethylation (me)
of H3K4, are commonly referred to as euchromatin modifications.
Modifications that are localized to inactive genes or regions, such
as H3 K9me and H3 K27me, are often termed heterochromatin
modifications. Most modifications are distributed in distinct
localized patterns within the upstream region, the core promoter,
the 50 end of the open reading frame (ORF) and the 30 end of the
ORF. Indeed, the location of a modification is tightly regulated
and is crucial for its effect on transcription. For instance, as we
will discuss later in more detail, Set2- mediated methylation of
histone H3K36 normally occurs within the ORF of actively
transcribed genes. However, if Set2 is mistargeted to the promoter
region through artificial recruitment, it represses transcription
(Landry et al., 2003; Strahl et al., 2002). Typically, histone
acetylation occurs at multiple lysine residues and is usually
carried out by a variety of histone acetyltransferase complexes
(HATs; Brown et al., 2000). Distinct patterns of lysine acetylation
on histones have been proposed to specify distinct downstream
functions such as the regulation of coexpressed genes (Kurdistani
et al., 2004). Another view posits that the biological functions of
histone acetylation rely primarily on the number of lysines
modified (e.g., a cumulative effect) with the one known exception
of H4K16Ac (Dion et al., 2005). In contrast to acetylation, histone
methylation, phosphorylation, ubiquitination, etc. are often
catalyzed by a specific enzyme at a specific site and result in
unique functions. The reason for the distinction between
acetylation and other modifications is currently unknown, but
biophysical changes caused by histone acetylation may offer a
partial explanation. Since their identification decades ago,
histone modifications have been proposed to have a number of
different functions (reviewed in Workman and Kingston, 1998).
However, a consensus has begun to emerge in recent years. First,
with the exception of methylation, histone modifications result in
a change in the net charge of nucleosomes, which could loosen
inter- or intranucleosomal DNA-histone interactions. This idea is
supported by the observation that acetylated histones are easier to
displace from DNA both in vivo (Reinke and Horz, 2003; Zhao et al.,
2005) and in vitro (Chandy et al., 2006; Hassan et al., 2006; Ito
et al., 2000). Second, it is well accepted that protein
modifications can be recognized by other proteins (reviewed in Seet
et al., 2006). Given the diversity of covalent modifications, it
has been proposed that individual histone modifications or
modification patterns might be read by other proteins that
influence chromatin dynamics and function (Jenuwein and Allis,
2001; Strahl and Allis, 2000; Turner, 2000). Therefore, the outcome
of a particular modification is dependent on the effector proteins
that recognize it. Third, some modifications directly influence
higher-order chromatin structure. For instance, acetylation of H4
K16 inhibits the formation of compact 30 nm fibers (Shogren-Knaak
et al., 2006). Finally, the mechanisms discussed above are not
necessarily mutually exclusive. For example, acetylation of H4 K16
also impairs the efficiency of ATP-dependent chromatin assembly and
mononucleosome mobilization by the ACF histone chaperone
(Shogren-Knaak et al., 2006), thus suggesting that a single
modification can elicit multiple effects on chromatin
structure.
Histone Modifications and Transcription
The well-defined landscape of chromatin modifications observed over
the body of a gene is striking in its detail. However, as we shall
discuss below, it is the consequence of an ordered recruitment of
various histone-modifying enzymes. This well-choreographed process
is likely a consequence of Pol II moving through the ORF while
struggling to maintain chromatin structure within the transcribed
region. Histone H3K4 Methylation The H3K4 residue in yeast is
methylated by the Set1 complex across the entire ORF of an active
gene (reviewed in Shilatifard, 2006).Monomethylation is enriched
toward the 30 end, and dimethylation peaks in the middle, whereas
trimethylation occurs around the transcription start site and the
50 end of the ORF (Pokholok et al,2005). One possible
interpretation of this distribution pattern is that K4me1 occurs at
a basal level; Set1 associates with elongating Pol II at the
beginning of the ORF and converts monomethyl into dimethyl and
eventually into trimethyl. Hence, the gradual addition of methyl
groups at the 50 ORF may then lead to the gradient of tri- and
dimethyl trailing off at the 30 end of the ORF. This hypothesis is
supported by the observation that in a paf1D mutant, both H3K4me2
and H3K4me3 are eliminated, but H3K4me1 is not affected. More
importantly, H3K4me1 increases at the 50 ORF (Dehe et al., 2005),
presumably due to the failure to convert H3K4me1 into H3K4me2 or
into H3K4me3 in the mutant. Therefore, Set1 can catalyze H3K4me1
independent of PAF, but conversion to H3K4me2 or -me3 requires PAF
and association with Pol II. This phenomenon resembles how the
MLL/WRD5 complex controls H3K4 methylation in humans, where
histones can be mono- and dimethylated at H3K4 without WDR5, a
WD-40 domain-containing protein (Wysocka et al., 2005). The
MLL/WRD5 complex can specifically recognize the dimethyl marks and
convert them into trimethylation (Wysocka et al., 2005). This
remarkable similarity accentuates the importance of di- and
trimethylation of H3K4 in transcription regulation. Coincidently,
H2B ubiquitination is only required for di- and trimethylation
(Dehe et al., 2005; Shahbazian et al., 2005), and the extent of
both modifications is positively correlated to the frequency of
transcription. Therefore, it is conceivable that these two marks
enriched at the 50 ORF may serve as a critical signal for defining
the start of the transcribed domain and the frequency with which
Pol II travels through it. However, the precise function of H3K4
methylation is still unknown. In a completely defined in vitro
transcription system, it has been shown that H3K4 methylation does
not affect transcription elongation per se (Pavri et al., 2006),
which is consistent with the in vivo observation that Set1 does not
affect elongation or processivity of Pol II (Mason and Struhl,
2005). These data imply that the importance of H3K4 methylation
might rest primarily in its signaling functions. Recent studies
provide some clues in this direction. Chromatin-remodeling factors
(NURF) and histone-modification complexes (hTip60, mSIN3/HDAC,
yNuA3, etc.) contain PHD domains that can specifically recognize
H3K4 methylation (see review by Zhang, 2006), thereby recruiting
their respective complexes to activate/repress transcription. In
addition, an elongation-related chromatin-remodeling factor Chd1
also recognizes methylated H3K4 (Pray-Grant et al., 2005; Figure
3A). Future studies addressing how these H3K4-binding complexes
influence transcription elongation will be of importance for
understanding the role of H3K4 methylation. Histone H2B
Monoubiquitination Histone H2B monoubiquitination (H2Bub1) occurs
at both promoters and ORFs (Kao et al., 2004; Xiao et al., 2005)
and is dependent on PAF and active transcription (Ng et al., 2003a;
Pavri et al., 2006; Wood et al., 2003). One commonly accepted role
of H2Bub1 in transcription is to stimulate di- and trimethylation
of histone H3K4 (Dehe et al., 2005; Shahbazian et al., 2005; Sun
and Allis, 2002). Due to the bulky nature of ubiquitin, it has been
speculated that its incorporation into nucleosomes would be
disruptive to their structure. However, biochemical studies
indicate that ubiquitination of histones has very little effect on
nucleosome architecture (Jason et al., 2002). Pavri et al. recently
reported that monoubiquitination of H2B enhances the rate of
transcription elongation on chromatin templates (Pavri et al.,
2006). It is noted that in this system the stimulatory effect
occurs while H2Bub1 remains in chromatin. This seems in contrast to
the in vivo observation that both ubiquitination and
deubiquitination are important for full transcription activation at
the GAL1 promoter (Henry et al., 2003). However, it is possible
that in the in vitro assay, deubiquitination may stimulate
transcription to a greater extent than does the initial effect of
ubiquitination or that deubiquitination is required only at the
promoter. Histone H3K36 Methylation Histone H3K36 methylation
mediated by Set2 is another important landmark on chromatin during
elongation. Both di- and trimethylation are enriched at the 30 ORF,
while only trimethylation displays a positive correlation with
transcription rates (Figure 1; Pokholok et al., 2005; Rao et al.,
2005). Our understanding of the role of K36 methylation in
elongation is much more advanced compared to the role of other
modifications in this process. H3K36 methylation is recognized by
the chromodomain of Eaf3, a subunit of the Rpd3S histone
deacetylase complex. Trimethylation leads to the recruitment of
Rpd3S and creates a hypoacetylated environment within ORFs
(Carrozza et al., 2005; Joshi and Struhl, 2005; Keogh et al.,
2005).
Nucleosomes as Transcription Barriers
The nucleosome forms a strong barrier to Pol II transcription in
vitro. Although the phage SP6, T7 RNA polymerases, and yeast Pol
III can transcribe through nucleosomal DNA by mobilizing histones
along the templates (Clark and Felsenfeld, 1992; Studitsky et al.,
1994, 1995, 1997), RNA Pol II can only traverse the nucleosome
under conditions in which at least one H2A/H2B dimer is lost
(Kireeva et al., 2002, 2005). How does Pol II overcome the
nucleosome barrier? When Pol II transcribes into a nucleosomal
template, it pauses at certain sites that are presumably related to
the strength or nature of the histone-DNA contacts (Bondarenko et
al., 2006; Kireeva et al., 2005). This pausing leads to Pol II
backtracking. The prototypic transcription elongation factor TFIIS
reactivates the backtracked Pol II complexes and promotes
transcription through the nucleosomal templates (Kireeva et al.,
2005; Kulish and Struhl, 2001). Consistent with this observation,
TFIIS was recently found to be a major component of chromatin
transcription-enabling activity (CTEA). CTEA strongly stimulates
transcription elongation through nucleosomes at a post-PIC step and
in a manner dependent upon p300 and acetyl-CoA (Guermah et al.,
2006). Biochemical and genetic experiments suggest that the FACT
histone chaperone complex can also help Pol II transcribe through
nucleosomes (reviewed in Reinberg and Sims, 2006). However, its
mechanism is different from that of TFIIS. The requirement for
stoichiometric amounts of FACT for nucleosomal transcription
initially suggested that FACT might act as a histone chaperone
(Orphanides et al., 1999). This notion is consistent with the
observation that passage of Pol II through nucleosome at high salt
conditions causes a quantitative loss of one H2A/H2B dimer (Kireeva
et al., 2002). It was ultimately shown that FACT does act as a
chaperone during transcription and that it functions in both
disassembly and reassembly of H2A/ H2B dimers (Belotserkovskaya et
al., 2003). ATP-dependent chromatin-remodeling complexes have long
been suspected of playing a role in helping Pol II pass through
nucleosomes (Workman and Kingston, 1998); however, direct evidence
did not emerge until recently. Using C-tail DNA templates
reconstituted with a histone octamer, Carey et al. demonstrated
that RSC can help Pol II transcribe through otherwise paused sites
on nucleosome templates. This reaction is further stimulated by
SAGA- and NuA4-mediated histone acetylation that presumably
utilizes the multiple bromodomains (acetyl-lysine-binding domains)
that are contained within the RSC complex (Carey et al., 2006). It
will be interesting to see if this effect involves active histone
eviction by RSC.
The N terminus.
(A) General chromatin organization. Like other histone "tails," the
N terminus of H3 represents a highly conserved domain that is
likely to be exposed or extend outwards from the chromatin fiber. A
number of distinct post-translational modifications are known to
occur at the N terminus f H3 including acetylation (green flag),
phosphorylation, and methylation. Other modifications are known and
may also occur in the globular domain.
(B) The N terminus of human H3 is shown in single-letter amino-acid
code. For comparison, the N termini of human CENP-A, a
centromere-specific H3 variant, and human H4, the nucleosomal
partner to H3, are shown. Note the regular spacing of acetylatable
lysines , and potential phosphorylation and methylation sites. The
asterisk indicates the lysine residue in H3 that is known to be
targeted for acetylation as well as for methylation; lysine 9 in
CENP-A may also be chemically modified.
Signaling Function of Remodeled Chromatin
Histone modification can open chromatin, thus permitting selective
binding of transcription factors that, in turn, recruit RNA
polymerase II (Turner, 2005). Varying levels and types of histone
modifications have been shown to correlate with levels of chromatin
activation. For example, one group of researchers used
antibody-based immunoprecipitation studies to determine that
acetylation of histone H3 and methylation at lysine residue K4
appeared to coincide with each other. They also coincided during
transcriptional activation in chicken embryos, while methylation at
lysine residue K9 marked inactive chromatin.
DNA Methylation
Another means by which transcription is controlled is through
methylation of the DNA strand itself. Not to be confused with
histone methylation, methylation of the DNA strand involves
cytosine bases of eukaryotic DNA being converted to
5-methylcytosine, resulting in the repression of transcription,
particularly in vertebrates and plants. The altered cytosine
residues are usually immediately adjacent to a guanine nucleotide,
resulting in two methylated cytosine residues set diagonally to one
another on opposing DNA strands Heavily methylated regions of DNA
with elevated concentrations of these so-called CpG groups are
often found near transcription start sites. In an interestingly
coordinated process, proteins that bind to methylated DNA also form
complexes with proteins involved in deacetylation of histones.
Therefore, when the DNA is in a methylated state, nearby histones
are deacetylated, resulting in compact, semipermanently silent
chromatin. Likewise, demethylated DNA does not draw deacetylating
enzymes to the histones, but it often attracts histone
acetyltransferases, allowing histones to remain acetylated and
promoting transcription.
Summary
Storage of eukaryotic DNA in small, compact nuclei requires that
this DNA be tightly coiled and compacted in the form of chromatin.
However, the structure of chromatin also appears to serve a second,
possibly more important role, in that it gives eukaryotic cells the
capability to exert complex levels of control over gene
expression.
As described throughout this article, chromatin and the DNA
sequences it contains are constantly undergoing modifications,
thereby periodically exposing different regions of DNA to
transcription factors and RNA polymerases. The cumulative effects
of these changes are various states of transcriptional control and
the ability of eukaryotic cells to turn genes on and off as needed.
This complexity provides eukaryotes with a means of making the most
of a relatively small number of genes. However, much research
remains to be performed before investigators precisely understand
how the many mechanisms of chromatin remodeling operate, as well as
how they work together to result in the complex patterns of gene
expression characteristic of eukaryotic cells.
In your own words, how do chromatin modifications regulate transcription? What modifications are observed in regions...
The trp and lac operons are regulated in various ways. How do bacteria regulate transcription of these operons? Sort the statements into the appropriate bins depending on whether or not each operon would be transcribed under the stated conditions.
The following sentences describe chromatin structure and how altering chromatin structure can affect gene expression. Complete each sentence using the words provided.In some cells, DNA combines with proteins to form a substance calledThe lowest level of chromatin structure consists of DNA wrapped twice around a group of histones to form a(n)The formation of nucleosomes may block the binding of transcription factors and RNA polymerase II to theThe structure of chromatin can be modified by altering either the DNA or the...
describe in your own words the instability associated with erythromycin and what structural modifications have been made to mitigate this instability. You should include examples of modifications to the structure that led to new macrolide antibiotics with increased acid stability. How did the modification change other properties of the drug? This may require additional research into erythromycin derivatives such as azithromycin, clarithromycin or other macrolide antibiotics.
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
What are your thoughts on States being able to regulate their own medical practices? How does it help and how does it hurt patient care?
What are your thoughts on states being able to regulate their own medical practices? How does it help and how does it hurt patient care?
describe in your own words process of transcription and translation. No less than 100 words
Response Questions Part A To B A) Use Your Own Words For Your Response: What is the law of supply? Give an example of how you have observed the law of supply at work. What is the relationship between the law of supply and the supply curve? B) Use Your Own Words For Your Response: How do markets coordinate the independent decisions of buyers and sellers?
Describe the process of transcription and translation, in your own words, starting from the DNA double helix and ending with an amino acid chain.
1. In your own words, how do you form a strong clinical question? 2.In your own words, why is a well-structured clinical question important?