Describe the process of transcription and translation, in your own words, starting from the DNA double helix and ending with an amino acid chain.
The DNA is a double stranded helix with opposite polarity from 5’ to 3’ and 3’ to 5’ direction. The DNA helix is opened up with the help of enzyme helicase and semi-conservative replication of DNA takes place in 5’ to 3’ direction on both the parent strands.
Transcription: The daughter DNA strands thus generated carry one half from their parents. These DNA strands then undergo transcription by a cascade of enzymes and utilization of energy. The transcription also takes place in 5’ to 3’ direction similar to DNA replication. The major enzyme involved in transcription is RNA polymerase. This enzymes generates a complementary copy of DNA by transcription on the coding strand of DNA. This copy of mRNA is then utilized for translation of proteins.
Translation: After transcription has completed, the resultant mRNA contains a unique sequence of nucleotides which together in a group of three nucleotides are called a codon. A codon encodes for a specific amino acid which are joined end to end to give rise to a polypeptide by the means of a peptide bond between each amino acid. The major part of translation of these codon to amino acids takes place on the ribosomes over the rough endoplasmic reticulum by the help of tRNA and enzyme tRNA amino actyl synthetase. The first amino acid in this polypeptide is always a methionine encoded by codon AUG. Thenafter, subsequent addition of amino acids takes place based upon their sequence on the parent DNA strand and the mRNA transcribed. As the termination codon arrives (UAA, UAG, UGA), translation stops and polypeptide chain terminates. This releases out the polypeptide amino acid chain which later modifies to give rise to a functional protien.
Thus, the processes of transcription and translation give rise to a linear chain of amino acids starting from simple sequences of nucleotide bases.
Describe the process of transcription and translation, in your own words, starting from the DNA double...
describe in your own words process of transcription and translation. No less than 100 words
Determine if the following words describe transcription, translation, or both transcription and translation. Nucleotide Ribosome Amino acid mRNA Nucleus DNA
Summarize the relationship between genes and proteins . Explain the purpose of transcription and translation. Describe the steps of transcription I State the enzyme or structures that perform transcription and translation. Contrast prokaryotic and eukaryotic mRNA . Describe the process of translation .Describe the role of tRNA in translation . Explain the role of codons and anticodons in translation. Explain the significance of stop codons and start codons. Given a double stranded DNA gene sequence, be able to produce the...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA tRNA translates mRNA and adds amino acids to the growing peptide chain making a protein mRNA leaves nucleus Introns are excised from hnRNA Addition of 5' cap and poly-A tail to mRNA
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
Complete a concept map of translation, indicate where it takes place, and describe what will happen if the anticodon is not attached to transfer RNA. A)DNA unzips ?transcription of mRNA ? mRNA leaves nucleus ? mRNA binds to ?ribosome ? tRNA brings in amino acid? tRNA anticodon binds to codon on mRNA ? peptide bond binds amino acids to form protein ? transport of the amino acids to the mRNA by tRNA continues until the mRNA translation is completed. This...
10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches to the molecule. With regard to translation, the begins translating a polypeptide after it attaches to the __ of an mRNA molecule. Start and stop codons are involved in the process of The start codon is , while the stop codons are 11. and Does the start codon specify an amino acid? If so, which one(s)? Do the stop codons specify an amino acid?...