ZuoTi.Pro
Question

6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding st
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

he coding strand and the mRNA are similar in sequence except for A to U.

The coding DNA strand: 5'-AGAGGGTTACCGGGGATTGTAGACTTCTC-3'
mRNA sequence: 5'-AGAGGGUUACCGGGGAUUGUAGACUUCUC-3'

The standard genetic code is used to translate the given mRNA sequence
(However, it is to be noted that there are no canonical start and stop codons in the given sequence)

Protein sequence: Arg-Gly-Leu-Pro-Gly-Ile-Val-Asp-Phe

pls provide a positive rating.

0 0
Add a comment
Know the answer?
Add Answer to:
6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • 1) Using the bacterial DNA sequence that the instructor gave you:

    1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • A strand of DNA has the base sequence GATTCA

    3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...

  • Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...

    Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...

  • 11. Using the DNA sequence below and the codon table on the projector, perform the following:...

    11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA transcript. On the DNA sequence below, the top strand is the template strand, and transcription begins immediately following the promoter sequence and ends at the end of the DNA sequence. (5 points) b. Produce the correct polypeptide sequence. (5 points) Prometer GTCACGGGTACCCTGTGTTAAGGCATCGTATGATACATACCACTATGTACCATGGACACAATTCCGTAGCATAAGCATGACCC CAGTGCCCATGGGACACAATTCCGTAGCATACTATGTATGGTGATACATGGTACCTGTGTTAAGGCATCGTATTCGTACTGGG 11. Using the DNA sequence below and the codon table on the projector, perform the following:...

  • 4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...

    4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...

  • 7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...

    7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...

  • Identify the structures in DNA Need help with all of these questions Coding strand Transcription 5'-CAGACCAGTTACTGACTGGCATTCAAECATGGATCCAGTATGCCTCGACGGTTATTGGCCGAGCCCCAAGTGGTCGCTCATGGGGAGTOGTCTAGTAGCAATGEATTTAGAGGTCACTAGTCA-3"...

    Identify the structures in DNA Need help with all of these questions Coding strand Transcription 5'-CAGACCAGTTACTGACTGGCATTCAAECATGGATCCAGTATGCCTCGACGGTTATTGGCCGAGCCCCAAGTGGTCGCTCATGGGGAGTOGTCTAGTAGCAATGEATTTAGAGGTCACTAGTCA-3" Transcription start site → stop site 3-GTQTGGTCAATATAATGACETAAGTTCGTACCTAGGTCATACGGAGCTGCCAATAACCGGCTCGGGGTTCÁCCAGCGAGTACCCGTCACCAGATCATCGTTACGTAATGTCCAGTGATCAGT-5' VI VII VIII Template strand Label Identify the structure Function Is the structure part of a mature mRNA? (Y/N) DTY What is the amino acid sequence produced from this locus? Identify N/C terminus and use the three- letter abbreviation on the codon chart VA Tyrone Tyd O ne Oy VAA Stop Trutnohon SA Histidin Hesi GAA Gent...

  • Shown below is the sequence of a coding strand of DNA that begins with what corresponds...

    Shown below is the sequence of a coding strand of DNA that begins with what corresponds to the translation start codon (AUG) in the mRNA transcript. You are analyzing two different mutants. Mutant #1 has an extra C residue after the underlined G residue and Mutant 2 has a deletion of the underlined A residue. Wild type 5’- ATGCTTACTGAGGTCATGGTACAGATGA Mutant 1 5’- ATGCTTACTGCAGGTCATGGTACAGATGA Mutant 2 5’- ATGCTTACTGAGGTCATGGTCAGATGA What is the amino acid sequence of the polypeptide encoded by: B. The...

  • In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

    In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT