Question 3: BIS gene expression is decreased in the cells expressing miR-5.
This is because miR-5 binds to 3’-UTR of mRNA of BIS gene and promotes its degradation.
Question 4: These cells will express increased amount of p101 protein due to low levels of BIS protein.
Normally, BIS inhibits p101 protein thereby keeping its level low. However, upon miR-5 expression, BIS (mRNA) is degraded thereby unable to inhibit p101.
Questions 3-4: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the...
In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form A different lung cancer cell line is found to have significantly decreased amounts of histone acetylation. Which...
In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form In a lung cancer cell line, the p101 protein is overly active leading to misregulation of gene...
Question: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3’UTR of the mRNA transcript encoded by the ABC gene. The ABC gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form. A. In a lung cancer cell line, the p101 protein is overly active leading to misregulation of...
Questions 8-9: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the MRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a DNA methyltransferase (DNMT) which is an enzyme that methylates DNA when the protein is in its active form. 8. 8. (1pt) In a lung cancer cell line, the p101 protein is overly active leading to...
4. (2pts) Which of the following is true concerning expression levels of the BIS gene in cells expressing miR-5? BIS gene expression is increased in these cells BIS gene expression is decreased in these cells BIS gene expression remains unchanged in cells expressing miR-5 Transcription initiation of BIS is negatively regulated Question 4 2 pts 5.(2pts) Which of the following are true of p101 expression in these cells? o increased amounts of the p101 protein due to low levels of...
please answer all 6 questions Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
molecular biology Section C (40 marks) Answer ALL questions from this Section 5. You have isolated total RNA from muscle cells and constructeda muscle cDNA library. You wish to study the regulatory region of a muscle-specific cDNA gene (gene M) that you have previously identified. 6 (a) For your study, you need to isolate a genomic clone of gene M. Why isa cDNA clone of gene M not appropriate for your study? (2 marks) (b) Outline the steps you would...
expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance of trp B. The trp operon would be transcribed much less than...
Page < 2 > of 2 D. The trp operon would be expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance...
For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...